View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_high_44 (Length: 252)
Name: NF11400_high_44
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_high_44 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 44709347 - 44709586
Alignment:
| Q |
13 |
cagagactcgatggatcactatggatcccgtagtgcgagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709347 |
cagagactcgatggatcactatggatcccgtagtgcgagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatg |
44709446 |
T |
 |
| Q |
113 |
tggaattgtgctgatggattggttgatgccgtagcgggatcaacggctattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709447 |
tggaattgtgctgatggattggttgatgccgtagcgggatcaacggctattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaaca |
44709546 |
T |
 |
| Q |
213 |
tctcatctacttattcttttgcttacatgcatgcatatat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709547 |
tctcatctacttattcttttgcttacatgcatgcatatat |
44709586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 49 - 141
Target Start/End: Complemental strand, 25007205 - 25007113
Alignment:
| Q |
49 |
gagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctgatggattggttgatgc |
141 |
Q |
| |
|
|||||||||||||| ||||| || ||||| |||||| |||||||||| |||||| |||| ||| | |||||| ||||||| ||| ||||||| |
|
|
| T |
25007205 |
gagtgatggtgatggtatttccatctttggtgctagtaatgtttggattgatcatgtttccatgagaaattgtactgatggtttgattgatgc |
25007113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University