View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_high_54 (Length: 234)
Name: NF11400_high_54
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 163 - 232
Target Start/End: Complemental strand, 34713405 - 34713336
Alignment:
| Q |
163 |
atatgttattaacttcnnnnnnnctatgttattcctagtttgacaatggacggaaaatcttatattggtc |
232 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34713405 |
atatgttattaacttctttttttctatgttattcctagtttgacaatggacggaaaatcttctattggtc |
34713336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University