View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11400_high_54 (Length: 234)

Name: NF11400_high_54
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11400_high_54
NF11400_high_54
[»] chr5 (1 HSPs)
chr5 (163-232)||(34713336-34713405)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 163 - 232
Target Start/End: Complemental strand, 34713405 - 34713336
Alignment:
163 atatgttattaacttcnnnnnnnctatgttattcctagtttgacaatggacggaaaatcttatattggtc 232  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||| ||||||||    
34713405 atatgttattaacttctttttttctatgttattcctagtttgacaatggacggaaaatcttctattggtc 34713336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University