View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_high_56 (Length: 220)
Name: NF11400_high_56
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_high_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 23 - 205
Target Start/End: Original strand, 51043758 - 51043941
Alignment:
| Q |
23 |
gaagggaagggaatagggaagaagaaattataaaataataattgcagagaaaaggagaagaaccaaagtaaataaactctaatctaacatctcctttgtt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51043758 |
gaagggaagggaatagggaagaagaaattataaaataataattgcagagaaaaggagaagaaccaaagtaaataaactctaatctaacatctcctttgtt |
51043857 |
T |
|
| Q |
123 |
gtctagctgatgtaacaaaat-nnnnnnncagctctctcttcatgtgaaactttgacaatcatatgattaaattggtttgtttc |
205 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51043858 |
gtctagttgatgtaacaaaataaaaaaaacagctctctcttcatgtgaaactttgacaatcatatgattaaattggtttgtttc |
51043941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University