View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_high_7 (Length: 612)
Name: NF11400_high_7
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 3e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 42028305 - 42028175
Alignment:
| Q |
18 |
acattatgatgcttccgctatctttgcatgccctatatccccactacagagttgcatgcgatgttgcagtggtagcgaaaaagtcatagcatatcagatt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42028305 |
acattatgatgcttccactatctttgcatgccctatatccccactacagagttgcatgcgatgttgcagtggtagcgaaaaagtcatagcatatcagatt |
42028206 |
T |
 |
| Q |
118 |
ttatagcattttgcccaaatctctcttcgca |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42028205 |
ttatagcattttgcccaaatctctcttcgca |
42028175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 463 - 544
Target Start/End: Original strand, 26629334 - 26629415
Alignment:
| Q |
463 |
tatttgtagtccttgacatggagagactcagaggcaccttcaccaagggtagaatcacctttataagttcccaaagttgctt |
544 |
Q |
| |
|
|||||||||||||| ||||| |||||||| || ||||| ||||||||| ||| || ||||| ||||||||| | |||||||| |
|
|
| T |
26629334 |
tatttgtagtccttaacatgaagagactccgaagcaccatcaccaaggttagcattaccttgataagttccaagagttgctt |
26629415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University