View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_low_27 (Length: 418)
Name: NF11400_low_27
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 4 - 408
Target Start/End: Complemental strand, 5418489 - 5418085
Alignment:
| Q |
4 |
ttttaaattacattaaaatcaaacggtcacttgtgtctcgactacgtgaatgcggattctagaaaacagttaaaccaaattcaaggttattgagtcaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418489 |
ttttaaattacattaaaatcaaacggtcacttgtgtctcgactaagtgaatgcggattctagaaaacagttaaaccaaattcaaggttattgagtcaatt |
5418390 |
T |
 |
| Q |
104 |
tatgagtcttttagctttggtttgtgaaatgtattgacatctcaaaattgcaagcaaagagacagctggatagtgggtttggtagtgtggtattatgtgc |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418389 |
tatgagtcttttagctttgttttgtgaaatgtattgacatctcaaaattgcaagcaaagagacagctggatagtgggtttggtagtgtggtattatgtgc |
5418290 |
T |
 |
| Q |
204 |
ggaagccgcgtacgtactttatggctttattgatccatactcgaatttaattgtcgtttgtcccctatatgtatatatattgattgatcatcaagatgaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418289 |
ggaagccgcgtacgtactttatggctttattgatccatactcgaatttaattgtcgtttgtcccctatatgtatatatattgattgatcatcaagatgaa |
5418190 |
T |
 |
| Q |
304 |
acgttgcatatgcatattgatattgtcaaattgccatattcattgcattgtatgagttgttcatagcaccaaaaactgtgtttgtttacgtggctttttt |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418189 |
acgttgcatatgcatattgatattgtcaaattgccatattcattgcattgtatgagttgttcatagcaccaaaaactgtgtttgtttacgtggctttttt |
5418090 |
T |
 |
| Q |
404 |
ctctg |
408 |
Q |
| |
|
||||| |
|
|
| T |
5418089 |
ctctg |
5418085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University