View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_low_30 (Length: 376)
Name: NF11400_low_30
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 21 - 365
Target Start/End: Original strand, 22734145 - 22734489
Alignment:
| Q |
21 |
acacataccctgcgttgctgcttctctatcaaatgggtttcgatcacttcaatatgaaatgagaaatgggctgttagaaacttcgaactaaccaccaaac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
22734145 |
acacataccctgcgttgctgcttctctatcaaatgggtttcgatcacttcaatatgaaatgagaaatgggcagttagaaacttagaactaaccaccaaac |
22734244 |
T |
|
| Q |
121 |
tctacttatttgaggcgtgtcggatactaatatggatatatacatctctcggaattcaagtttaggttcaccacattgtgggtagtttagcacattgcat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22734245 |
tctacttatttgaggcgtgtcggatactaatatggatatatacatctctcggaattcaagtttaggttcaccacattgtgggtagtttagcacattgcat |
22734344 |
T |
|
| Q |
221 |
tagactcaacctgcactagaatcaacctcgttggtttgacggaagggtctaaacttctacaacatggcgaactaaggttcaaattccgattgagaaaagt |
320 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22734345 |
tagactcaacatgcactagaatcaacctcgttggtttgacggaagggtctaaacttctacaacatggcgaactaaggttcaaattccgattgagaaaagt |
22734444 |
T |
|
| Q |
321 |
aaccatatttgatgtccggcatgcctccaaatataactacttctt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22734445 |
aaccatatttgatgtccggcatgcctccaaatataactacttctt |
22734489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University