View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_low_40 (Length: 305)
Name: NF11400_low_40
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_low_40 |
 |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
| [»] scaffold0687 (1 HSPs) |
 |  |  |
|
| [»] scaffold0532 (1 HSPs) |
 |  |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0321 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 36)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 21658618 - 21658836
Alignment:
| Q |
5 |
caatatttggtagaacctttggaacaactatggtgatatccttggcctgagcagcccagagggcctccaaccctaaattcagtgttgtttgggtgttgaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
21658618 |
caatatttggtagaacctttggaacaactaaggtgatatccttggactgagcagcccagagggcctctaaccctacattcagtgttgtttgggtgttgaa |
21658717 |
T |
 |
| Q |
105 |
ttcctttatcatgatttttcaaggtgtgtttcaactaagactcgtgatattgatttatatgtaagaaatttgagaatcgtacatcatctaacattaatta |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21658718 |
ttcctttatcatgattcttcaaggtgtgtttcaactaagactcgtgatattgatttatatgtaagaaatttgagaatcgtacatcatctaacattaatta |
21658817 |
T |
 |
| Q |
205 |
agagaaacgttatgtaacc |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21658818 |
agagaaacgttatgtaacc |
21658836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 237 - 295
Target Start/End: Original strand, 11633642 - 11633700
Alignment:
| Q |
237 |
aacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
11633642 |
aacaacttttgcaacaactttctctctcatattcacattactttttactttatctctct |
11633700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 32767706 - 32767763
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
32767706 |
acaacttttgcaataattttctctctcatactcacattattttttactttatctctct |
32767763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 238 - 296
Target Start/End: Complemental strand, 10207014 - 10206956
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctctg |
296 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| |||||||||||| |
|
|
| T |
10207014 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctctctg |
10206956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 235 - 293
Target Start/End: Original strand, 26996343 - 26996401
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| || |||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
26996343 |
gtaacaacttttgtaacaactttctctctcatactcacattattttttactttatctct |
26996401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 8821660 - 8821717
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
8821660 |
acaacttttgtaacaactttctctctcatactcacattattttttactttatctctct |
8821717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 30909059 - 30909116
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||| |||||| ||||||||||| |
|
|
| T |
30909059 |
acaacttttgcaacaactttctctcttatattcacattactttttactttatctctct |
30909116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 44677525 - 44677468
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
44677525 |
acaacttttgcaacaattttctctctcatactcacattattttttactttatctctct |
44677468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 49363292 - 49363235
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
49363292 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
49363235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 49417605 - 49417662
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
49417605 |
acaacttttgtgacaactttctctctcatactcacattattttttattttatctctct |
49417662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 50207011 - 50206954
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
50207011 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
50206954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 390841 - 390896
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
390841 |
aacttttgcaacaactttttctctcatactcacattattttttactttatctctct |
390896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 24483004 - 24482949
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||| |
|
|
| T |
24483004 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctct |
24482949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 29634111 - 29634056
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
29634111 |
aacttttgcaacaattttctctcttatattcatattattttttacattatctctct |
29634056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 37508537 - 37508482
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
37508537 |
aacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
37508482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 295
Target Start/End: Complemental strand, 32421659 - 32421613
Alignment:
| Q |
249 |
aataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
32421659 |
aataactttctctctcatactcatatcattttttactttatctctct |
32421613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 33375890 - 33375947
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| ||| || ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
33375890 |
acaacttttacaacaattttctctctcatactcacattattttttactttatctctct |
33375947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 39020200 - 39020143
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
39020200 |
acaacttttacaataactttttctctcatactcacattactttttactttatctctct |
39020143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 3347161 - 3347117
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttat |
284 |
Q |
| |
|
||||||||| | |||||||||||||||||||| |||||||||||| |
|
|
| T |
3347161 |
aacttttgctacaactttctctctcatattcacattattttttat |
3347117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 22371223 - 22371278
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||| ||||||||||||| | | ||||||||||| ||||||||||| |
|
|
| T |
22371223 |
aacttttgtaataattttctctctcatacttacattattttttactttatctctct |
22371278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 236 - 295
Target Start/End: Complemental strand, 28419257 - 28419198
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||| |||||||| | ||||| | | ||||||||||| ||||||||||| |
|
|
| T |
28419257 |
taacaacttttgcaacaactttctttttcatacttacattattttttactttatctctct |
28419198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 49761351 - 49761394
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
49761351 |
aactttctctctcatactcacattattttttactttatctctct |
49761394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 294
Target Start/End: Original strand, 8846519 - 8846577
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||||||||||| | || ||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
8846519 |
taacaacttttgtgacaattttctctctcatactcacattattttttactttatctctc |
8846577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 34456820 - 34456878
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| |||||| ||| ||||||| |
|
|
| T |
34456820 |
acaacttttgtgataactttctctctcatactcatattatctttttactttctctctct |
34456878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 39671139 - 39671081
Alignment:
| Q |
238 |
acaacttttgcaataactttctctc-tcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
39671139 |
acaacttttgcaacaactttctctcttcatactcacattactttttactttatctctct |
39671081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 253 - 295
Target Start/End: Complemental strand, 51465940 - 51465898
Alignment:
| Q |
253 |
actttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
51465940 |
actttctctctcatactcatattactttttactttatctctct |
51465898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 54773795 - 54773737
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatt-ttttattttatctctct |
295 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
54773795 |
acaacttttataacaactttctctctcatactcatattatttttttactttatctctct |
54773737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 286
Target Start/End: Original strand, 55013035 - 55013081
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattt |
286 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
55013035 |
aacttttgcaacaactttctctcttatattcacattactttttattt |
55013081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 295
Target Start/End: Complemental strand, 27718831 - 27718770
Alignment:
| Q |
234 |
tgtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
27718831 |
tgtaacaacttttgtgacaactttctctctcatactcacatatgtttttattttatctctct |
27718770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 37927246 - 37927189
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
37927246 |
acaacttttgtgacaactttctctctcatactcacataattttttactttatctctct |
37927189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 46019492 - 46019549
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
46019492 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
46019549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 46253652 - 46253709
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||| ||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
46253652 |
acaacttttgcaacaattttttctctcatactcacattactttttactttatctctct |
46253709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 55400029 - 55400086
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
55400029 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
55400086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 39697258 - 39697206
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||| || |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
39697258 |
ttttgtaacaactttctctctcatactcacattactttttactttatctctct |
39697206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 295
Target Start/End: Original strand, 43905008 - 43905060
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||| || |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
43905008 |
ttttgtaacaactttctctctcatactcacattactttttactttatctctct |
43905060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 48353024 - 48353084
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||||||| |||||| ||| ||||||| |
|
|
| T |
48353024 |
taacaacttttgtgacaactttctctctcatactcatattatatttttactttctctctct |
48353084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 30)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 15267814 - 15267871
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15267814 |
acaacttttgcaacaactttctctctcatattcatattattttttactttatctctct |
15267871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 35099046 - 35098989
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
35099046 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
35098989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 234 - 295
Target Start/End: Original strand, 43441764 - 43441825
Alignment:
| Q |
234 |
tgtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
43441764 |
tgtaacaacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
43441825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 18842360 - 18842305
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
18842360 |
aacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
18842305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 240 - 294
Target Start/End: Original strand, 15478690 - 15478744
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
15478690 |
aacttttgcaataattttctctctcatactcacattattttttactttatctctc |
15478744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 2689027 - 2688970
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| | ||||||||||| ||||||||||| |
|
|
| T |
2689027 |
acaacttttgcaacaactttctctttcatatttacattattttttactttatctctct |
2688970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 294
Target Start/End: Complemental strand, 8267861 - 8267805
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
8267861 |
acaatttttgcaacaactttctctctcatactcacattattttttactttatctctc |
8267805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 292
Target Start/End: Complemental strand, 21064267 - 21064213
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctc |
292 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| |||||||| |
|
|
| T |
21064267 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctc |
21064213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 4430977 - 4430920
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
4430977 |
acaacttttgcaacaactttttctctcatactcacatcattttttactttatctctct |
4430920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 5042278 - 5042335
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||||| |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
5042278 |
acaatttttgcaacaactttatctctcatactcacattattttttactttatctctct |
5042335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 287
Target Start/End: Original strand, 12878786 - 12878823
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttatttt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12878786 |
ataactttctctctcatattcatattattttttttttt |
12878823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 20770161 - 20770218
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
20770161 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
20770218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 30640820 - 30640877
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
30640820 |
acaacttttgttacaactttctctctcatatttacattattttttactttatctctct |
30640877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 33620638 - 33620695
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||| ||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
33620638 |
acaacttttgcaacaattttttctctcatacttatattattttttactttatctctct |
33620695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 282
Target Start/End: Complemental strand, 16437606 - 16437562
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
16437606 |
acaacttttgcaacaactttctctctcatactcacattatttttt |
16437562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 6931098 - 6931043
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||| ||| ||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
6931098 |
aacttttgcaacaactttatctttcatactcacattattttttactttatctctct |
6931043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 8675472 - 8675417
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| || ||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
8675472 |
aacttttgcaacaattttctctctcatactcacattactttttactttatctctct |
8675417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 15953072 - 15953029
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
15953072 |
aactttttctctcatactcatattattttttactttatctctct |
15953029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 41175733 - 41175690
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
41175733 |
aactttctctctcatactcacattattttttactttatctctct |
41175690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 4771527 - 4771584
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||| | |||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
4771527 |
acaaattttgctacaactttctcttgcatactcacattattttttattttatctctct |
4771584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 6517742 - 6517799
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
6517742 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
6517799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 25871487 - 25871430
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||| |||| |||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
25871487 |
acaatttttgctataattttctctctcatgctcacattattttttactttatctctct |
25871430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 32360526 - 32360489
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattat |
277 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
32360526 |
aacttttgccataattttctctctcatattcatattat |
32360489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 295
Target Start/End: Original strand, 37700502 - 37700547
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
37700502 |
ataactttctctctcatactcacattattttttaccttatctctct |
37700547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 291
Target Start/End: Original strand, 39628819 - 39628872
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatct |
291 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
39628819 |
acaacttttgtgacaactttctctctcatattcacattatttttaactttatct |
39628872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 8097281 - 8097337
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatatta-ttttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
8097281 |
aacttttgtgataactttctcactcatactcatattatttttttattttttctctct |
8097337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 295
Target Start/End: Complemental strand, 14321998 - 14321938
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| | | |||||||| ||||||| |
|
|
| T |
14321998 |
taacaacttttgtgacaactttctctctcatattcatattgtatatttattttctctctct |
14321938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 251 - 295
Target Start/End: Complemental strand, 18397193 - 18397149
Alignment:
| Q |
251 |
taactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||||| | | |||| |||||||||||||||||| |
|
|
| T |
18397193 |
taactttctctctcatacttacattactttttattttatctctct |
18397149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 250 - 282
Target Start/End: Complemental strand, 31683525 - 31683493
Alignment:
| Q |
250 |
ataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
31683525 |
ataactttctctctcatattcatattatgtttt |
31683493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 293
Target Start/End: Original strand, 32639086 - 32639129
Alignment:
| Q |
252 |
aactttctctctcatattcata--ttattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
32639086 |
aactttctctctcatattcatattttattttttattttttctct |
32639129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 5e-16; HSPs: 48)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 23822286 - 23822231
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
23822286 |
acaacttttgcaacaactttctccctcatattcatattattttttactttatctct |
23822231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 30079876 - 30079933
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
30079876 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
30079933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 12112671 - 12112714
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12112671 |
aactttctctctcatattcatattattttttactttatctctct |
12112714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 237 - 295
Target Start/End: Original strand, 35820200 - 35820258
Alignment:
| Q |
237 |
aacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
35820200 |
aacaacttttacaacaactttctctctcatattcatattactttttactttttctctct |
35820258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 624353 - 624296
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
624353 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
624296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 9118905 - 9118848
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
9118905 |
acaacttttgcaacaattttctctctcataatcacattattttttactttatctctct |
9118848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 13086052 - 13086109
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
13086052 |
acaacttttgtaacaactttctctctcatactcacattactttttattttatctctct |
13086109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 14010159 - 14010102
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
14010159 |
acaacttttacaataactttttctctcatactcatattactttttactttatctctct |
14010102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 51887693 - 51887750
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
51887693 |
acaacttttgctacaactttctctctcatactcaaattattttttactttatctctct |
51887750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 240 - 293
Target Start/End: Complemental strand, 53152360 - 53152307
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53152360 |
aacttttgcaacaattttttctctcatattcatattattttttactttatctct |
53152307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 6494920 - 6494877
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
6494920 |
aactttctctctcatattcatattattttttactttatttctct |
6494877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 22819679 - 22819734
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||| |
|
|
| T |
22819679 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctct |
22819734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 41486182 - 41486127
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
41486182 |
aacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
41486127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 282
Target Start/End: Original strand, 20118809 - 20118855
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
20118809 |
taacaacttttgcaataactttctctcttatattcacattatatttt |
20118855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 294
Target Start/End: Complemental strand, 53654777 - 53654735
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
53654777 |
aactttctctttcatattcatattattttttactttatctctc |
53654735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 14451423 - 14451480
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
14451423 |
acaactttagcaacaactttctctctcatactcacattagtttttactttatctctct |
14451480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 21260328 - 21260385
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
21260328 |
acaacttttgcaacaactttttctctcatactcacattatttttttctttatctctct |
21260385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 240 - 293
Target Start/End: Complemental strand, 25318104 - 25318051
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||| | || ||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
25318104 |
aacttttgcgacaattttctctctcatactcatattattttttactttatctct |
25318051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 28458418 - 28458361
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
28458418 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
28458361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 30170061 - 30170004
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
30170061 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
30170004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 235 - 295
Target Start/End: Complemental strand, 36111440 - 36111379
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatatta-ttttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| ||| |||| ||||||| ||||||||||| |
|
|
| T |
36111440 |
gtaacaacttttgcaacaactttatctctcatactcacattacttttttactttatctctct |
36111379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 39345021 - 39344964
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
39345021 |
acaatttttgcaacaactttctctctcatactcacattactttttactttatctctct |
39344964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 46406015 - 46405958
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
46406015 |
acaacttttgcaacaactttttctctcatactcacattaatttttactttatctctct |
46405958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 47099052 - 47099109
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||| |||| |||||| ||||||||||| |
|
|
| T |
47099052 |
acaacttttgcaacaactttctctcacatactcacattactttttactttatctctct |
47099109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 291
Target Start/End: Original strand, 48335584 - 48335637
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatct |
291 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
48335584 |
acaatttttgcaacaattttctctctcatattcacattattttttactttatct |
48335637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 282
Target Start/End: Complemental strand, 5932198 - 5932154
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
5932198 |
acaacttttgcaacaactttctctctcatactcacattatttttt |
5932154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 26207013 - 26206961
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
26207013 |
ttttgcaacaattttctctctcatattcacattactttttactttatctctct |
26206961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 49768354 - 49768302
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||| | |||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
49768354 |
ttttgctacaactttctctctaatactcatattattttttactttatctctct |
49768302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 6141819 - 6141764
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| | |||| ||||||||| |
|
|
| T |
6141819 |
acaacttttgcaacaactttctctctcatactcacattactctttactttatctct |
6141764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 14527674 - 14527729
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||| | ||||||| |||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
14527674 |
acaacttttgctacaactttcactctcatactcacattattttttactttatctct |
14527729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 21617227 - 21617270
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
21617227 |
aactttctctctcatactcacattattttttactttatctctct |
21617270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 28657468 - 28657425
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
28657468 |
aactttctctctcatactcacattattttttactttatctctct |
28657425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 250 - 293
Target Start/End: Original strand, 32696223 - 32696266
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
32696223 |
ataactttctctctcatattcacattgttttttactttatctct |
32696266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 47965769 - 47965824
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| |||| |||||| ||||||||| |
|
|
| T |
47965769 |
acaacttttgcaacaactttttctctcatactcacattactttttactttatctct |
47965824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 295
Target Start/End: Complemental strand, 11546930 - 11546884
Alignment:
| Q |
250 |
ataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
11546930 |
ataactttctctctcatattcatattatatttttactttctctctct |
11546884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 293
Target Start/End: Complemental strand, 22027466 - 22027428
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
22027466 |
tttctctctcatactcatattatgttttattttatctct |
22027428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 2256371 - 2256314
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||| ||||| |||||| |||||||| ||||||||||| |
|
|
| T |
2256371 |
acaacttttgtgacaactttctctatcatactcatataattttttactttatctctct |
2256314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 9362719 - 9362663
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
9362719 |
acaacttttgtgacaactttctatctcatattcatattat-ttttactttatctctct |
9362663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 13263438 - 13263381
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||| ||| ||| |||||||||| ||||||||||| |
|
|
| T |
13263438 |
acaacttttgctacaactttctctcttatactcactttattttttactttatctctct |
13263381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 33899367 - 33899310
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||| || |||| ||| |||||||||| ||||||||||| |
|
|
| T |
33899367 |
acaacttttgcaacaactttctttcacatactcacattatttttttctttatctctct |
33899310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 38338963 - 38338906
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
38338963 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
38338906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 293
Target Start/End: Complemental strand, 39312643 - 39312602
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
39312643 |
aactttctctctcatactcacattattttttatattatctct |
39312602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 293
Target Start/End: Original strand, 43769755 - 43769796
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
43769755 |
aactttctctctcatactcacattattttttactttatctct |
43769796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 295
Target Start/End: Complemental strand, 1796025 - 1795965
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||| ||||| |||||| ||||||||||| |
|
|
| T |
1796025 |
taacaacttttgtgataactttatctctcatactcacattatatttttactttatctctct |
1795965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 282
Target Start/End: Original strand, 26910231 - 26910275
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
|||||||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
26910231 |
acaacttttgtgacaactttctctctcgtattcatattatttttt |
26910275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 295
Target Start/End: Original strand, 31076081 - 31076141
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || | |||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
31076081 |
gtaacaacttctgggacaactttctctctcatactcacatcattttttactttatctctct |
31076141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 282
Target Start/End: Original strand, 39478464 - 39478508
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
39478464 |
acaacttttgtgacaactttctctctcatactcatattatttttt |
39478508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 282
Target Start/End: Original strand, 43175013 - 43175057
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| |||||||||| |
|
|
| T |
43175013 |
acaacttttgtgataactttctctctcatactcacattatttttt |
43175057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 37)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 4758678 - 4758623
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4758678 |
aacttttgcaacaactttctctttcatattcacattattttttattttatctctct |
4758623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 7552585 - 7552642
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
7552585 |
acaacttttgtaacaactttctctctcatatttatattactttttattttatctctct |
7552642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 12889873 - 12889816
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
12889873 |
acaacttttgctacaactttctctctcatactcacattattttttaatttatctctct |
12889816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 18176970 - 18177027
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
18176970 |
acaacttttgcaacaactttctctctcatactcacattatttttttctttatctctct |
18177027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 26738921 - 26738864
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||| ||||||| | | ||||||||||||||||||||||| |
|
|
| T |
26738921 |
acaacttttgcaacaactttctttctcatacttacattattttttattttatctctct |
26738864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 234 - 295
Target Start/End: Complemental strand, 34119697 - 34119636
Alignment:
| Q |
234 |
tgtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
34119697 |
tgtaacaacttttacgacaactttctctctcatactcacattattttttactttatctctct |
34119636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 36802926 - 36802983
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
36802926 |
acaacttttgctacaactttctctctcatactcacattattttttactttatctctct |
36802983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 39213811 - 39213754
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
39213811 |
acaacttttgcaacaactttatctctcatactcacattattttttactttatctctct |
39213754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 39449297 - 39449354
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
39449297 |
acaacttttgcaacaactttctctctcatactcagattactttttactttatctctct |
39449354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 235 - 295
Target Start/End: Complemental strand, 12498680 - 12498620
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||| ||||| | |||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12498680 |
gtaacaatttttgtgacaactttttctctcatactcatattattttttattttatctctct |
12498620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 37257479 - 37257537
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctca-tattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||| || ||| ||||||||||| ||||||||||| |
|
|
| T |
37257479 |
acaacttttgcaacaactttctctctcattactcacattattttttactttatctctct |
37257537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 2464290 - 2464233
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||||| | ||||||||||| |
|
|
| T |
2464290 |
acaacttttgtgacaactttctttctcatattcatattatttttaactttatctctct |
2464233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 295
Target Start/End: Original strand, 9377498 - 9377543
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
9377498 |
ataactttctctctcatattcacattactttttactttatctctct |
9377543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 13347856 - 13347799
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
13347856 |
acaatttttgcaacaactttctctctcatactcacattactttttactttatctctct |
13347799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 295
Target Start/End: Original strand, 26206889 - 26206934
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
26206889 |
ataactttctctctcatactcacattattttttactttatctctct |
26206934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 28245758 - 28245815
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
28245758 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
28245815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 35589428 - 35589371
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
35589428 |
acaacttttgcaacaattttctctctcatactcacattactttttactttatctctct |
35589371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 295
Target Start/End: Complemental strand, 40937093 - 40937048
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
40937093 |
ataactttctctctcatactcacattattttttactttatctctct |
40937048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 295
Target Start/End: Original strand, 433885 - 433937
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| |||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
433885 |
ttttgcaacaactttctctctcatactcacatcattttttactttatctctct |
433937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 4952516 - 4952464
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| |||||||| | ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4952516 |
ttttgcaacaactttctatttcatattcacattattttttactttatctctct |
4952464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 16799700 - 16799760
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
16799700 |
taacaatttttgtgataactttctctctcatactcatattatatttttattttctctctct |
16799760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 252 - 296
Target Start/End: Original strand, 25881588 - 25881632
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctctg |
296 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
25881588 |
aactttctctctcatactcacattattttttactttatctctctg |
25881632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 33616493 - 33616553
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
33616493 |
taacaaattttgtgataactttctctctcatattcatattatatttttactttctctctct |
33616553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 42678793 - 42678836
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
42678793 |
aactttctctctcatactcacattattttttactttatctctct |
42678836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 44254629 - 44254684
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||| | |||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
44254629 |
acaacttttgttacaactttctctctcatactcgtattattttttactttatctct |
44254684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 296
Target Start/End: Original strand, 2841864 - 2841922
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctctg |
296 |
Q |
| |
|
|||||||||| | |||||||| ||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
2841864 |
acaacttttgttacaactttctttctcatactcacattattttttactttatctctctg |
2841922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 293
Target Start/End: Original strand, 6336280 - 6336338
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctct |
293 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
6336280 |
taacaacttttgtgacaactttctctctcatactcatattatatttttattttctctct |
6336338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 252 - 294
Target Start/End: Original strand, 36517240 - 36517282
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
36517240 |
aactttctcttttatattcatattattttttactttatctctc |
36517282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 295
Target Start/End: Original strand, 2221035 - 2221080
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| | ||||||||||| |
|
|
| T |
2221035 |
ataactttctctctcatactcacattatttttcactttatctctct |
2221080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 6999109 - 6999052
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
6999109 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
6999052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 14233760 - 14233703
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | || ||||||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
14233760 |
acaacttttgtgacaaatttctctctcatactcatattactttttactttatctctct |
14233703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 293
Target Start/End: Original strand, 18723638 - 18723679
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
18723638 |
aactttctctctcatactcacattattttttactttatctct |
18723679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 293
Target Start/End: Complemental strand, 23352932 - 23352891
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
23352932 |
aactttctctctcatactcacattattttttactttatctct |
23352891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 295
Target Start/End: Original strand, 38560704 - 38560765
Alignment:
| Q |
234 |
tgtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||| | |||||||| | ||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
38560704 |
tgtaacaacttttgttacaactttctttgtcatactcacattattttttactttatctctct |
38560765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 30546393 - 30546354
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
30546393 |
tttctctctcatattcatattat-ttttactttatctctct |
30546354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 36774566 - 36774626
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| ||||| |||||| ||| ||||||| |
|
|
| T |
36774566 |
taacaacttttgagacaactttctctctcatattcacattatatttttactttctctctct |
36774626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 43650577 - 43650533
Alignment:
| Q |
252 |
aactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | ||||||| |
|
|
| T |
43650577 |
aactttctctctcatattcatattatatttttattctctctctct |
43650533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 8244 - 8301
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||| |||||| |||| |
|
|
| T |
8244 |
acaacttttgcaacaactttctctctcatattcatattactttttactttatccctct |
8301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 34)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 1633931 - 1633874
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
1633931 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
1633874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 11017835 - 11017892
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
11017835 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
11017892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 11658041 - 11657984
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
11658041 |
acaacttttgcaacaactttctctctcatactcacattactttttattttatctctct |
11657984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 30136056 - 30136001
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
30136056 |
acaacttttgcaacaactttctctctcatattcacattactttttactttatctct |
30136001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 7592879 - 7592936
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
7592879 |
acaacttttgcaacaactttatctctcatagtcacattattttttactttatctctct |
7592936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 7956048 - 7955991
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
7956048 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctctct |
7955991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 16966815 - 16966872
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||| || ||||||||||| |
|
|
| T |
16966815 |
acaacttttgcaacaactttctctctcatactcacattattttctactttatctctct |
16966872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 37784012 - 37783955
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
37784012 |
acaacttttgcaacaactttctctctcatactcagattactttttactttatctctct |
37783955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 40739953 - 40739896
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
40739953 |
acaacttttgcaacaattttttctctcatattcacattattttttactttatctctct |
40739896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 294
Target Start/End: Complemental strand, 33589271 - 33589215
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
33589271 |
acaacttttgcaacaattttctctctcatactcacattattttttactttatctctc |
33589215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 5277745 - 5277688
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||| ||||| | || ||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
5277745 |
acaacctttgctacaattttctctctcatactcacattattttttattttatctctct |
5277688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 236 - 293
Target Start/End: Original strand, 13970947 - 13971004
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13970947 |
taacaacttttgtgacaactttctctctcatactcatattatattttattttctctct |
13971004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 16327193 - 16327136
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
16327193 |
acaacttttgcgacaactttctctctcatactcacattactttttactttatctctct |
16327136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 16872197 - 16872140
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||| ||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
16872197 |
acaacttttgcaacaactttctctatcatactcacattactttttactttatctctct |
16872140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 34718145 - 34718202
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
34718145 |
acaacttttgttacaactttctctctcatactcacattattttttactttatctctct |
34718202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 41159930 - 41159873
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
41159930 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
41159873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 45529287 - 45529230
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| ||||| || |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
45529287 |
acaatttttgtaacaactttctctctcatactcacattattttttactttatctctct |
45529230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 12655954 - 12656010
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
12655954 |
aacttttgtaataactttttctctcatattcatattatatttttactttctctctct |
12656010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 292
Target Start/End: Original strand, 41521000 - 41521052
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctc |
292 |
Q |
| |
|
||||||||||| || ||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
41521000 |
aacttttgcaacaattttctctctcatactcacattattttttactttatctc |
41521052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 29029000 - 29028945
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| | |||||||||||| ||| ||| ||||||||||| ||||||||||| |
|
|
| T |
29029000 |
aacttttgctacaactttctctcttatactcacattattttttaatttatctctct |
29028945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 30439533 - 30439490
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
30439533 |
aactttctctctcatactcacattattttttactttatctctct |
30439490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 41541901 - 41541944
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
41541901 |
aactttctctcttatactcacattattttttattttatctctct |
41541944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 294
Target Start/End: Complemental strand, 2731002 - 2730945
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattat-tttttattttatctctc |
294 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||||| |||||| ||| |||||| |
|
|
| T |
2731002 |
acaacttttgtaacaactttctctctcatattcacattatctttttactttctctctc |
2730945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 295
Target Start/End: Original strand, 4994423 - 4994468
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
4994423 |
ataactttatctctcatactcacattattttttactttatctctct |
4994468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 295
Target Start/End: Complemental strand, 6991837 - 6991792
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
6991837 |
ataattttctctctcatactcacattattttttactttatctctct |
6991792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 9549240 - 9549183
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | || ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
9549240 |
acaacttttgtgacaattttctctctcatactcacattattttttactttatctctct |
9549183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 12707179 - 12707236
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||| ||| |||||| ||||||||||| |
|
|
| T |
12707179 |
acaacttttgcgacaactttctctctcatactcacgttactttttaatttatctctct |
12707236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 16613664 - 16613721
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||| | |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
16613664 |
acaatttttgctacaactttttctctcatactcacattattttttactttatctctct |
16613721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 34018838 - 34018895
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| |||| |||||| |||||| |||| |
|
|
| T |
34018838 |
acaacttttgcaacaattttctctctcatactcacattactttttactttatcactct |
34018895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 293
Target Start/End: Complemental strand, 42569756 - 42569715
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
42569756 |
aactttctctctcatattcacattactttttactttatctct |
42569715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 281
Target Start/End: Original strand, 42886019 - 42886048
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42886019 |
aactttctctctcatattcatattattttt |
42886048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 8671595 - 8671539
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||| || ||||| |||||| ||||||||||| |
|
|
| T |
8671595 |
aacttttgtaataactttctctctcatactcgcattatatttttactttatctctct |
8671539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 282
Target Start/End: Complemental strand, 32847728 - 32847684
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||| |||||||||| |
|
|
| T |
32847728 |
acaacttttgcaacaactttctctcttatactcacattatttttt |
32847684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 35564324 - 35564372
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatct |
291 |
Q |
| |
|
|||||||| |||||||| ||||||| ||| ||||||||||| ||||||| |
|
|
| T |
35564324 |
ttttgcaacaactttctatctcatactcacattattttttactttatct |
35564372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 35)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 11564923 - 11564980
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
11564923 |
acaacttttgctataactttctctctcatactcacattattttttactttatctctct |
11564980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 13162949 - 13163006
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
13162949 |
acaacttttgcaacaactttctctctcatactcatattactttttactttatctctct |
13163006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 39231769 - 39231712
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
39231769 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
39231712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 43573584 - 43573527
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
43573584 |
acaacttttgcaacaactttctctctcatattcacattactttttactttatctctct |
43573527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 243 - 295
Target Start/End: Original strand, 40353299 - 40353351
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
40353299 |
ttttgcaacaactttctctctcatactcacattattttttattttatctctct |
40353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 16708204 - 16708247
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16708204 |
aactttctttctcatattcatattattttttattttatctctct |
16708247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 17682440 - 17682483
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17682440 |
aactttctttctcatattcatattattttttattttatctctct |
17682483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 13729756 - 13729813
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
13729756 |
acaacttttgcaacaactttctttctcatactcacattattttttactttatctctct |
13729813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 21023158 - 21023101
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
21023158 |
acaacttttgcgataattttctctttcatattcacattattttttactttatctctct |
21023101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 28036774 - 28036831
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||| ||||||||||| ||||||||||| |
|
|
| T |
28036774 |
acaacttttgcaacaactttctctcttatactcacattattttttactttatctctct |
28036831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 289
Target Start/End: Original strand, 8929755 - 8929807
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattat-tttttattttat |
289 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
8929755 |
acaacttttgcaataattttctctctcatatttatattatgtttttattttat |
8929807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 235 - 295
Target Start/End: Complemental strand, 29163020 - 29162960
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
29163020 |
gtaacaacttttacaacaactttctctctcatactcacattactttttactttatctctct |
29162960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 282
Target Start/End: Original strand, 41402537 - 41402581
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatttttt |
282 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
41402537 |
acaacttttgcaacaactttctctctcatactcatattatttttt |
41402581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 16980327 - 16980384
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||| |||| |||||| ||||||||||| |
|
|
| T |
16980327 |
acaacttttgcaacaactttctctcttatactcacattactttttactttatctctct |
16980384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 19786120 - 19786063
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||| |||| |||||| ||||||||||| |
|
|
| T |
19786120 |
acaacttttgcaacaactttctctcacatactcacattactttttactttatctctct |
19786063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 21559828 - 21559885
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
21559828 |
acaacttttgctacaactttatctctcatactcacattattttttactttatctctct |
21559885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 295
Target Start/End: Complemental strand, 41399192 - 41399147
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
41399192 |
ataactttatctctcatactcatattattttttactttatctctct |
41399147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 46812946 - 46812889
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||| ||||| | ||||||||||| ||||||||||| |
|
|
| T |
46812946 |
acaacttttgctacaactttctctcttatatttacattattttttactttatctctct |
46812889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 295
Target Start/End: Original strand, 25067270 - 25067310
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
25067270 |
tttctctcttatattcatattattttttactttatctctct |
25067310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 3293173 - 3293216
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
3293173 |
aactttctctctcatattcacataattttttactttatctctct |
3293216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 4713617 - 4713660
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
4713617 |
aactttctctctcaaattcacattattttttactttatctctct |
4713660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 29002638 - 29002693
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| ||||||||||||| || ||| |||| |||||| ||||||||| |
|
|
| T |
29002638 |
acaacttttgcaacaactttctctctcgtaatcacattactttttactttatctct |
29002693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 38779783 - 38779728
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||| ||||||||||| || |||||||| |
|
|
| T |
38779783 |
aacttttgcaacaactttttctctcatactcacattattttttacttcatctctct |
38779728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 47078278 - 47078235
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
47078278 |
aactttctctctcatactcacattattttttactttatctctct |
47078235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 295
Target Start/End: Complemental strand, 28249599 - 28249553
Alignment:
| Q |
250 |
ataactttctctctcatattcatattatt-ttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
28249599 |
ataactttttctctcatattcacattattattttattttatctctct |
28249553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 32815198 - 32815255
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||||| || ||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
32815198 |
acaatttttgcaacaattttttctctcatactcacattattttttactttatctctct |
32815255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 37808805 - 37808748
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||||| || ||||||||||||| | | ||||||||||| ||||||||||| |
|
|
| T |
37808805 |
acaatttttgcaacaattttctctctcatacttacattattttttactttatctctct |
37808748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 39332015 - 39332072
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||| ||| ||| |||| |||||| ||||||||||| |
|
|
| T |
39332015 |
acaacttttgtaacaactttctctcttatactcacattactttttactttatctctct |
39332072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 44184600 - 44184543
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
44184600 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
44184543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 3343354 - 3343314
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
3343354 |
tttctctctcatattcacattactttttactttatctctct |
3343314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 280
Target Start/End: Complemental strand, 18067915 - 18067887
Alignment:
| Q |
252 |
aactttctctctcatattcatattatttt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18067915 |
aactttctctctcatattcatattatttt |
18067887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 31398153 - 31398212
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatatt--attttttattttatctctct |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| ||| |||||||||||| ||||||| |
|
|
| T |
31398153 |
acaacttttgtgataactttctctctcatactcacattacattttttattttctctctct |
31398212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 33180734 - 33180694
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
33180734 |
tttctctctcatactcacattattttttactttatctctct |
33180694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 35588927 - 35588875
Alignment:
| Q |
243 |
ttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| ||| | ||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
35588927 |
ttttgcaataattttttatcttatattcacattattttttactttatctctct |
35588875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 42584830 - 42584890
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||| ||||| |||||| ||||||||||| |
|
|
| T |
42584830 |
taacaacttttgtgacaactttctctctcatactcacattatatttttactttatctctct |
42584890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 49)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 8411759 - 8411702
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
8411759 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
8411702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 9008255 - 9008312
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
9008255 |
acaacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
9008312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 46172448 - 46172391
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
46172448 |
acaacttttgtaataattttctctctcatactcacattattttttattttatctctct |
46172391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 244 - 295
Target Start/End: Complemental strand, 3024785 - 3024734
Alignment:
| Q |
244 |
tttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
3024785 |
tttgcaataattttctctctcatactcatattattttttactttatctctct |
3024734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 29586021 - 29586080
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
29586021 |
taacaacttttgcaacaattttctctctcatactcacattattttttactttatctctct |
29586080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 756886 - 756943
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
756886 |
acaacttttgcaacaactttctttctcatactcacattattttttactttatctctct |
756943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 3603141 - 3603198
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
3603141 |
acaacttttgcaacaactttctctctcatactcacattactttttagtttatctctct |
3603198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 291
Target Start/End: Complemental strand, 4514495 - 4514442
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatct |
291 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
4514495 |
acaacttttgcaacaactttctatctcatattcacattattttttactttatct |
4514442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 7128148 - 7128205
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
7128148 |
acaacttttgcaacaacttcctctctcatattcacattattttctactttatctctct |
7128205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 21486358 - 21486301
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
21486358 |
acaactattgtaataactttctctctcatactcacattattttttactttatctctct |
21486301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 33024612 - 33024555
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
33024612 |
acaacttttgcaacaactttctctctcatactcacattatttttttctttatctctct |
33024555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 33054129 - 33054072
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
33054129 |
acaacttttgctacaactttctctctcatactcacattattttttactttatctctct |
33054072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 252 - 293
Target Start/End: Original strand, 38713614 - 38713655
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38713614 |
aactttctctctcatattcatattattttttactttatctct |
38713655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 51286408 - 51286351
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
51286408 |
acaacttttgtgacaactttctctctcatactcacattattttttattttatctctct |
51286351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 34040539 - 34040484
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
34040539 |
aacttttacaacaactttctctctcatactcacattattttttactttatctctct |
34040484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 36577453 - 36577398
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| ||||||||| |
|
|
| T |
36577453 |
acaacttttgcaacaactttctctctcatactcacattactttttactttatctct |
36577398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 1790538 - 1790595
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| |||||| |||||| |||| |
|
|
| T |
1790538 |
acaacttttgcaacaactttctctctcatactcaaattactttttactttatccctct |
1790595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 1852992 - 1852935
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||| ||| ||||||| |
|
|
| T |
1852992 |
acaacttttgcaacaactttctctctcatactcacattatttttttctttgtctctct |
1852935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 295
Target Start/End: Complemental strand, 21093387 - 21093342
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
21093387 |
ataactttctcattcatattcacattattttttattttatctctct |
21093342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 21340552 - 21340609
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||| ||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
21340552 |
acaacttttgcaacaactttctctttcatactcacattactttttactttatctctct |
21340609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 35136874 - 35136931
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
35136874 |
acaacttttgcaacaactttctttctcatactcacattactttttactttatctctct |
35136931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 46082162 - 46082105
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||| |||| |||||| ||||||||||| |
|
|
| T |
46082162 |
acaacttttgcaacaactttctctcgcatactcacattactttttactttatctctct |
46082105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 47214238 - 47214295
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
47214238 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
47214295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 47721439 - 47721496
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
47721439 |
acaacttttgtgacaactttctgtctcatattcacattattttttactttatctctct |
47721496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 47728431 - 47728488
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
47728431 |
acaacttttgtgacaactttctgtctcatattcacattattttttactttatctctct |
47728488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 52362512 - 52362569
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
52362512 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
52362569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 295
Target Start/End: Complemental strand, 20565162 - 20565102
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||| |||| | |||| ||||||||||| |
|
|
| T |
20565162 |
gtaacaatttttgcaacaactttctctctcatactcacattactctttactttatctctct |
20565102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 295
Target Start/End: Original strand, 26837479 - 26837539
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||| ||| |||||| ||||||||||| |
|
|
| T |
26837479 |
gtaacaacttttgcaacaattttctctctcatactcacgttactttttactttatctctct |
26837539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 38303728 - 38303672
Alignment:
| Q |
239 |
caacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||| ||| |||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
38303728 |
caacttttacaacaactttctctctcatactcgcattattttttactttatctctct |
38303672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 294
Target Start/End: Original strand, 44294045 - 44294101
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||| ||||||||||| ||||| |||| |
|
|
| T |
44294045 |
acaatttttgcaataattttctctctcatactcacattattttttactttatttctc |
44294101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 49931581 - 49931641
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
49931581 |
taacaacttttgtgacaactttctctctcatattcacattatatttttactttatctctct |
49931641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 295
Target Start/End: Original strand, 50824788 - 50824828
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
50824788 |
tttctctctcatactcatattattttttactttatctctct |
50824828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 36494507 - 36494550
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
36494507 |
aactttctctctcatactcatattatttttcactttatctctct |
36494550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 36673758 - 36673715
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
36673758 |
aactttctctctcatactcatgttattttttactttatctctct |
36673715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 44632572 - 44632615
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
44632572 |
aactttctctctcatactcacattattttttactttatctctct |
44632615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 48220171 - 48220128
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
48220171 |
aactttctctctcatactcacattattttttactttatctctct |
48220128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 236 - 295
Target Start/End: Complemental strand, 49559242 - 49559184
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
49559242 |
taacaacttttgtgacaactttctctctcatatttacatta-tttttattttatctctct |
49559184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 48325997 - 48326055
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatatta-ttttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| | | |||| ||||||| ||||||||||| |
|
|
| T |
48325997 |
acaacttttgcaacaactttctctctcatacttacattatttttttactttatctctct |
48326055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 902668 - 902725
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| || |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
902668 |
acaacttttataacaactttctctctcatactcacattactttttactttatctctct |
902725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 10890087 - 10890030
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
10890087 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
10890030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 13489692 - 13489749
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
13489692 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
13489749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 26585920 - 26585863
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||| ||||||||||| |||||| |||| |
|
|
| T |
26585920 |
acaacttttgcaacaactttctctcctatactcacattattttttactttatcgctct |
26585863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 26967240 - 26967296
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
26967240 |
acaacttttgtgacaactttctctctcacattcacatta-tttttattttatctctct |
26967296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 32915113 - 32915056
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
32915113 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
32915056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 281
Target Start/End: Complemental strand, 42598998 - 42598969
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42598998 |
aactttctctctcatattcatattattttt |
42598969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 50328182 - 50328125
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||| ||||| ||| ||| |||||| ||||||||||| |
|
|
| T |
50328182 |
acaacttttgcaacaactttctctttcatactcacgttactttttactttatctctct |
50328125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 250 - 294
Target Start/End: Complemental strand, 4469457 - 4469413
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctc |
294 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
4469457 |
ataattttctctctcttactcatattattttttactttatctctc |
4469413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 295
Target Start/End: Original strand, 49570024 - 49570084
Alignment:
| Q |
236 |
taacaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| ||||| |||||| ||| ||||||| |
|
|
| T |
49570024 |
taacaacttttgtgacaactttctctctcatattcacattatatttttactttctctctct |
49570084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 50882134 - 50882094
Alignment:
| Q |
255 |
tttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
50882134 |
tttctctctcatatttacattattttttactttatctctct |
50882094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 27)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 868979 - 868936
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
868979 |
aactttctctctcatattcatattattttttactttatctctct |
868936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 4820283 - 4820338
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
4820283 |
aacttttgcaacaactttctctctcatactcacattattttttactttatctctct |
4820338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 2075488 - 2075435
Alignment:
| Q |
242 |
cttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
2075488 |
cttttgcaacaactttctctctcatactcacattattttttactttatctctct |
2075435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 11547570 - 11547513
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
11547570 |
acaacttttgcaacaattttctctctcatactcacattattttttactttatctctct |
11547513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 30036835 - 30036778
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
30036835 |
acaacttttgcaacaactttctctctcataatcacataattttttactttatctctct |
30036778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 30152571 - 30152514
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
30152571 |
acaacttttgcaacaactttctctctcatactcacataattttttactttatctctct |
30152514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 754479 - 754422
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
754479 |
acaacttttgcaacaactttttctctcatactcacattactttttactttatctctct |
754422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 13143423 - 13143366
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
13143423 |
acaatttttgcaacaactttctctctcatactcacattactttttactttatctctct |
13143366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 35213602 - 35213545
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
35213602 |
acaacttttgtaacaactttctctctcatactcacattactttttactttatctctct |
35213545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 295
Target Start/End: Complemental strand, 22341218 - 22341158
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
22341218 |
gtaacaacttttgtgataacattctctctcatactcacatcattttttactttatctctct |
22341158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 335093 - 335148
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||| || || ||||||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
335093 |
acaacttttgtaacaaatttctctctcatactcatattatttttaactttatctct |
335148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Complemental strand, 3611000 - 3610945
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
3611000 |
aacttttgcaacaactttttctctcatactcacattactttttactttatctctct |
3610945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 6531210 - 6531167
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
6531210 |
aactttctctctcatactcacattattttttactttatctctct |
6531167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 15318229 - 15318174
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
15318229 |
acaacttttgttacaactttctctctcatattcacattattatttactttatctct |
15318174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 34504052 - 34504107
Alignment:
| Q |
240 |
aacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||| |||| | ||||||||||| |
|
|
| T |
34504052 |
aacttttgcaacaactttctctctcatactcacattacttttcactttatctctct |
34504107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 5327633 - 5327575
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattatt-ttttattttatctctct |
295 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
5327633 |
acaacttttataacaactttctctctcatactcatattatttttttactttatctctct |
5327575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 296
Target Start/End: Complemental strand, 14699693 - 14699647
Alignment:
| Q |
250 |
ataactttctctctcatattcatattattttttattttatctctctg |
296 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
14699693 |
ataactttctttctcatactcacattattttttactttatctctctg |
14699647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 17551420 - 17551362
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||| ||||| |||||| ||||||||||| |
|
|
| T |
17551420 |
acaacttttgtaacaactttctctctcatactcacattatgtttttactttatctctct |
17551362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 32459558 - 32459500
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatatta-ttttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
32459558 |
acaacttttgtgacaactttctctctcatattcacattacttttttactttatctctct |
32459500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 293
Target Start/End: Original strand, 3199004 - 3199045
Alignment:
| Q |
252 |
aactttctctctcatattcatattattttttattttatctct |
293 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
3199004 |
aactttctctctcatactcacattatttttcattttatctct |
3199045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 8747199 - 8747256
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||| || ||||||| ||||||||||| |
|
|
| T |
8747199 |
acaacttttgttacaactttctctctcatactcatttttttttttactttatctctct |
8747256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 18141342 - 18141285
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
18141342 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
18141285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 20822909 - 20822852
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
20822909 |
acaacttttgtgacaactttctctctcatactcacattactttttactttatctctct |
20822852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 295
Target Start/End: Original strand, 32046724 - 32046785
Alignment:
| Q |
234 |
tgtaacaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||| || | ||| |||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
32046724 |
tgtaacaacttatgtgacaaccttctctctcatactcacattattttttactttatctctct |
32046785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 283
Target Start/End: Complemental strand, 2777360 - 2777312
Alignment:
| Q |
235 |
gtaacaacttttgcaataactttctctctcatattcatattatttttta |
283 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||| |||| |||||| |
|
|
| T |
2777360 |
gtaacaacttttgcaacaattttctctctcatactcacattacttttta |
2777312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 15974651 - 15974695
Alignment:
| Q |
252 |
aactttctctctcatattcatattat-tttttattttatctctct |
295 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
15974651 |
aactttctctctcatattcacattatctttttattttctctctct |
15974695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 31869096 - 31869155
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatatt--attttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
31869096 |
acaacttttgtgacaactttctctctcatactcatatttcattttttattttctctctct |
31869155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0687 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0687
Description:
Target: scaffold0687; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 2227 - 2284
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
2227 |
acaacttttgcaacaactttatctctcatagtcacattattttttactttatctctct |
2284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0532 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0532
Description:
Target: scaffold0532; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 10994 - 11051
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
10994 |
acaacttttgtgacaactttctctctcatactcacattattttttactttatctctct |
11051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0449 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 295
Target Start/End: Original strand, 9233 - 9290
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctctct |
295 |
Q |
| |
|
|||||||||| || |||||||||||| ||| |||||||| |||||| ||||||||||| |
|
|
| T |
9233 |
acaacttttgaaacaactttctctcttatactcatattactttttactttatctctct |
9290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 291
Target Start/End: Original strand, 23106 - 23159
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatct |
291 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
23106 |
acaatttttgcaacaattttctctctcatattcacattattttttactttatct |
23159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0321 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0321
Description:
Target: scaffold0321; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 19666 - 19720
Alignment:
| Q |
238 |
acaacttttgcaataactttctctctcatattcatattattttttattttatctc |
292 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||| | |||| |||||||| |
|
|
| T |
19666 |
acaacttttgcaacaactttctctctcatactcacattactctttactttatctc |
19720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University