View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11400_low_48 (Length: 252)

Name: NF11400_low_48
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11400_low_48
NF11400_low_48
[»] chr4 (1 HSPs)
chr4 (13-252)||(44709347-44709586)
[»] chr8 (1 HSPs)
chr8 (49-141)||(25007113-25007205)


Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 44709347 - 44709586
Alignment:
13 cagagactcgatggatcactatggatcccgtagtgcgagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44709347 cagagactcgatggatcactatggatcccgtagtgcgagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatg 44709446  T
113 tggaattgtgctgatggattggttgatgccgtagcgggatcaacggctattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaaca 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44709447 tggaattgtgctgatggattggttgatgccgtagcgggatcaacggctattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaaca 44709546  T
213 tctcatctacttattcttttgcttacatgcatgcatatat 252  Q
    ||||||||||||||||||||||||||||||||||||||||    
44709547 tctcatctacttattcttttgcttacatgcatgcatatat 44709586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 49 - 141
Target Start/End: Complemental strand, 25007205 - 25007113
Alignment:
49 gagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctgatggattggttgatgc 141  Q
    ||||||||||||||  ||||| || ||||| |||||| |||||||||| |||||| |||| ||| | |||||| ||||||| ||| |||||||    
25007205 gagtgatggtgatggtatttccatctttggtgctagtaatgtttggattgatcatgtttccatgagaaattgtactgatggtttgattgatgc 25007113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University