View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_low_63 (Length: 211)
Name: NF11400_low_63
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 199
Target Start/End: Complemental strand, 43537657 - 43537486
Alignment:
| Q |
28 |
tatatatattggacccaactagaagggtattttggtagttgtatccataaagctctaatctcttaactggcctttatatagagttttgctccacatgatt |
127 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537657 |
tatatatataggacccaactagaagggtattttggtagttgtatccataaagctctaacctcttaactggcctttatatagagttttgctccacatgatt |
43537558 |
T |
|
| Q |
128 |
gttatatatccattccattttcatataatcccgcgattttcttctcaagcaatcctgtctcctgtctctgct |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
43537557 |
gttatagatccattccattttcatataatcccgcgattttcttctcaagcaatactgtctcctgtttctgct |
43537486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University