View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11401_high_7 (Length: 392)
Name: NF11401_high_7
Description: NF11401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11401_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 18 - 378
Target Start/End: Original strand, 36276955 - 36277315
Alignment:
| Q |
18 |
ggaacaagaacataaaactagattaattgccacgaacaacttggttacaaactaggacaaaaaccaaactataagagcacgattatgaaagcaagactgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36276955 |
ggaacaagaacataaaactagattaattgccacgaacaacttggttacaaactaggacaaaaaccaaactataagagcacaattatgaaagcaagactgc |
36277054 |
T |
 |
| Q |
118 |
aactttgaagaaagtgtccccctccaaaaaacacccttaatagctaaacttattttgtgcaactttagctataaatagcattagcacgtacaatcacttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36277055 |
aactttgaagaaagtgtccccctccaaaaaacaccctaaatagctaaacttattttgtgcaactttagctataaatagcattagcacgtacaatcacttt |
36277154 |
T |
 |
| Q |
218 |
tagtttatggttttaatcaatttcaacgtcttctggcagctgtttctctttgtgcattgnnnnnnncagcagccacaggaggcccgaggtcattgtcttg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36277155 |
tagtttatggttttaatcaatttcaacgtcttctggcagctgtttctctttgtgcattgaaaaaaacagcagccacaggaggcccgaggtcattgtcttg |
36277254 |
T |
 |
| Q |
318 |
tgcaaatttccttgtgttaaagagatctcttgatgttggtattttcatcactgtctgtctg |
378 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36277255 |
tgcaaatttctttgtgttaaagagatctcttgatgttggtattttcatcactgtctgtctg |
36277315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University