View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11401_low_13 (Length: 271)
Name: NF11401_low_13
Description: NF11401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11401_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 5 - 254
Target Start/End: Complemental strand, 5266328 - 5266078
Alignment:
| Q |
5 |
atgaatatggatgttgatactttttt-agtggcatgatcgtagtttagtaaccatattttaattaatgatatcatatacctatgtagtgcttcttttctt |
103 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5266328 |
atgaatatggatgcttatactttttttagtggcatgatcgtagtttagtaaccatattttaattaatgatatcatatacctatttagtgcttcttttctt |
5266229 |
T |
 |
| Q |
104 |
gaaaaaataatacctctgcatcttgtcttatttactttgttttttatttcttatctatagaccgtaagcatttgattttgagacgtaaatataaggttga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5266228 |
gaaaaaataatacctctgcatcttgtcttatttactttgttttttatttcttatctatagaccgtaagcatttgattttgagacgtaaatataaggttga |
5266129 |
T |
 |
| Q |
204 |
aaaatgaattgacaagtcaaatatatgtccctaccaccctatgaaatgagt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5266128 |
aaaatgaattgacaagtcaaatatatgtccctaccaccctatgaaatgagt |
5266078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University