View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11401_low_6 (Length: 415)
Name: NF11401_low_6
Description: NF11401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11401_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 88 - 409
Target Start/End: Original strand, 19368873 - 19369177
Alignment:
| Q |
88 |
caataataaacatattccttggagtacagggacaaacatgattatttccaacacttcactttctggtaattacattcaaattccattttctaattccata |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19368873 |
caataataaacatattccttggagtacaggggcaaacatgattatttccaacacttcactttctggtaattacattcaaattccattttctaattccata |
19368972 |
T |
 |
| Q |
188 |
ccagactttttaactgtcaaagcttttacagtgaggatcaatcatccaaatcttcccttaattaatgaagttatctcaaaaccatccattcttttttgga |
287 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19368973 |
cca-----------------agcttttacagtgaggatcaatcatccaaatcctcccttaattaatgaagttatctcaaaaccatccattcttttttgga |
19369055 |
T |
 |
| Q |
288 |
taaaatccaacttagatggaggtgctttaggtacttgtgtcaaaattcaacggatgatcgagaatcatcagaagtttgctgctcaaaaggatctctgatc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19369056 |
taaaatccaacttagatggaggtgctttaggtacttgtttcaatcttcaacggatgatcgagaatcatcagaagtttgctgctcaaaaggatctctgatc |
19369155 |
T |
 |
| Q |
388 |
ctaacattgtctttcttctctc |
409 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19369156 |
ctaacattgtctttcttctctc |
19369177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 97
Target Start/End: Original strand, 19368826 - 19368859
Alignment:
| Q |
64 |
ctttagtagaaaccaaagtaggttcaataataaa |
97 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
19368826 |
cttttgtagaaaccaaagtaggttcaataataaa |
19368859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University