View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11402_high_35 (Length: 256)
Name: NF11402_high_35
Description: NF11402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11402_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 77 - 170
Target Start/End: Original strand, 32986661 - 32986755
Alignment:
| Q |
77 |
aattctcaatcaattttagtgtcgtttgtttgttgctacacaattgttgcactctagaaggtacagagaaactattattataaaat-attttgtt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32986661 |
aattctcaatcaattttagtgtcgtttgtttgttgctacacaattgttgcactctagaaggtacagagaaactattattataaaatgattttgtt |
32986755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 170 - 241
Target Start/End: Original strand, 32986817 - 32986888
Alignment:
| Q |
170 |
ttcctttcaccttgaatttcctttttcaattcattcccctacgatctctatcactacccttatgtttggcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32986817 |
ttcctttcaccttgaatttcctttttcaattcattcccctacgatctctatcactacccttatgtttggcat |
32986888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 32986623 - 32986662
Alignment:
| Q |
1 |
tcaaacgtgagatttgaataccttagaaatatgagataaa |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32986623 |
tcaaacgtgagatttgaataccttagaaatatgggataaa |
32986662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University