View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11402_high_40 (Length: 240)
Name: NF11402_high_40
Description: NF11402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11402_high_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 34127114 - 34126892
Alignment:
| Q |
1 |
tgaagtcctcgatagtcctcatgaaggcggggattattcgatattagacagctgtatgttggtttggcgacataggcttagacatagtccggaacacaat |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34127114 |
tgaagtcctcagtagtcctcatgaaggcggggattattcgatattagacagctgtatgttggtttggcgacataggcttagacatagtccggaacacaat |
34127015 |
T |
|
| Q |
101 |
aaattatgttcaaggtagaagcttgggtgtttgatttgcagcagcaagtttggagataagttgaagcatatgtttgaagtggaagtgcttatggtgagtt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34127014 |
aaattacgttcaaggtagaagcttgggtgtttgatttgcagcagcaagcttggagataagttgaagcatatgtttgaagtggaagtgcttatggtgagtt |
34126915 |
T |
|
| Q |
201 |
cctttagcatagaacccaccttg |
223 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
34126914 |
cctttagcataaaacccaccttg |
34126892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University