View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11402_low_21 (Length: 372)
Name: NF11402_low_21
Description: NF11402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11402_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 18 - 357
Target Start/End: Complemental strand, 31770978 - 31770638
Alignment:
| Q |
18 |
attctttcatcatcaaggtagttcatttccctcttctccaacttttctgtgtttttgagatcacttaggaaaactacttgaccacaatgatatagtagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770978 |
attctttcatcatcaaggtagttcatttccctcttctccaacttttctgtatttttgagatcacttaggaaaactacttgaccacaatgatatagtagtt |
31770879 |
T |
|
| Q |
118 |
atgtaaattgagatccctgcacttttttgtttgttgtaaactgggtatcatcctcgcgcaactagaaaattaatccctggagccgagtacagccataata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770878 |
atgtaaattgagatccctgcacttttttgtttgttgtaaactgggtatcatcctcgcgcaactagaaaattaatccctggagccgagtacagccataata |
31770779 |
T |
|
| Q |
218 |
ggcaacacatccctcccttaagatttttaacactgttatatctctagggctcgattccaatccatgacatctgatgaaactggaagataaccgaatcatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770778 |
ggcaacacatccctcccttaagatttttaacactgttatatctctagggctcgattccaatccatgacatctgatgaaactggaagataaccgaatcatc |
31770679 |
T |
|
| Q |
318 |
-catcctaacactattgggtcaatacttgcacatctgacct |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770678 |
tcatcctaacactattgggtcaatacttgcacatctgacct |
31770638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University