View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11402_low_24 (Length: 325)
Name: NF11402_low_24
Description: NF11402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11402_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 77 - 309
Target Start/End: Complemental strand, 37430606 - 37430374
Alignment:
| Q |
77 |
gtgtcaggtcagcattactaagcaataaacaacaactcacgacacgggaaactgaaactgaaaagtcaataagggcaacctagttacatttcttagcaaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37430606 |
gtgtcaggtcagcattactaagcaataaacaacaactcacgacacgggaaactgaaactgaaaagtcaataagggcaacctagttccatttcttagcaaa |
37430507 |
T |
|
| Q |
177 |
acgactccatcacaagactttctcttcttttcttacacacataacataacataacaagaacggttattaatattatcatcaatcaaatttaaacaccctt |
276 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37430506 |
acgacttcatcacaagactttctcttcttttcttacacacataacataacataacaagaacggttattaatattatcatcaatcaaatttaaacaccctt |
37430407 |
T |
|
| Q |
277 |
gttctgtttctctttacaatcacacacaaccca |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37430406 |
gttctgtttctctttacaatcacacacaaccca |
37430374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University