View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11403_low_6 (Length: 272)
Name: NF11403_low_6
Description: NF11403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11403_low_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 272
Target Start/End: Complemental strand, 40857635 - 40857379
Alignment:
| Q |
15 |
tcaaataacttgaacaaacaaaacaaaaataaatcattaatgggtataatttcaaaaaccaaatgttttggatgtgtattttttctcattgaaacatctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
40857635 |
tcaaataacttgaacaaacaaaacaaaaataaatcattaatgggtataatttcaaaaaccaaatgttttggatgtttagtttttctcattgaatcatctt |
40857536 |
T |
 |
| Q |
115 |
gacatatttgtgatgctgggacctttttacttttgaaattcacgaccgtggttgcttatgtggcacttttactgcaggagtacatttgtccaaaattcgt |
214 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40857535 |
gacatatttgtgttactgggtcctttttacttttgaaattcacgaccgtggttgcttatgtggcacttttactgcaggagtacatttgtccaaaattggt |
40857436 |
T |
 |
| Q |
215 |
gaggccatgtcattacgttatcaatattaaatatcgtataaatttagctagctgaaat |
272 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40857435 |
gagg-catgtcattacgttatcaatattaaatatcatataaatttagctagctgaaat |
40857379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University