View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11403_low_7 (Length: 237)
Name: NF11403_low_7
Description: NF11403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11403_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 25 - 225
Target Start/End: Complemental strand, 10680227 - 10680027
Alignment:
| Q |
25 |
cgtgcatcgacagagcagctgtagcttgagtcttgcattgaataatgaatgtcgtgtcttgcatcatgtacatgtttagtaatcatgtttagtattaagc |
124 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680227 |
cgtgcatcgacagagtagctgtagctcgagtcttgcattgaataatgaatgtcgtgtcttgcatcatgtacatgtttagtaatcatgtttagtattaagc |
10680128 |
T |
 |
| Q |
125 |
aatttatatatagtatgattcctcaccatactcattaggcctctacnnnnnnnncaattgacaaaaattctattccatccaacagcaaactttttcctat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680127 |
aatttatatatagtatgattcctcaccatactcattaggcctctacttttttttcaattgacaaaaattctattccatccaacagcaaactttttcctat |
10680028 |
T |
 |
| Q |
225 |
g |
225 |
Q |
| |
|
| |
|
|
| T |
10680027 |
g |
10680027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University