View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11405_high_29 (Length: 224)
Name: NF11405_high_29
Description: NF11405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11405_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 50238141 - 50238242
Alignment:
| Q |
1 |
cccttttcttttcttaattagggtttccaccttcaattcaacaacaatagcgcgggtgtggtgagatagatagatagaggtgatgtaaagtgaaaaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50238141 |
cccttttcttttcttaattagggtttccaccttcaattcaacaacaatagagcgggtgtggtgagatagatagatagaggtgatgtaaagtgaaaaagaa |
50238240 |
T |
|
| Q |
101 |
aa |
102 |
Q |
| |
|
|| |
|
|
| T |
50238241 |
aa |
50238242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 50238262 - 50238312
Alignment:
| Q |
127 |
actcaaattccatatttgtccctacctaatcagtaaacttgatgtccgtcc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50238262 |
actcaaattccatatttgtccctacctaatcagtaaacttgatgtccgtcc |
50238312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University