View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11406_high_12 (Length: 327)
Name: NF11406_high_12
Description: NF11406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11406_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 5998877 - 5999039
Alignment:
| Q |
16 |
aacctttcatcaattcttgtttatttctagttctaggtgttacattt---cctgaataagaataagannnnnnnngttctctaattttctctcttttgaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5998877 |
aacctttcatcaattcttgtttatttctagttctaggtgttacattttttcctgaataagaataagattttttttgttctctaattttctctcttttgaa |
5998976 |
T |
 |
| Q |
113 |
aagtggcttcacctttcttaagtactttttcactgcatgtaacacatcaaaatcaaatctcag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998977 |
aagtggcttcacctttcttaagtactttttcactgcatgtaacacatcaaaatcaaatctcag |
5999039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 211 - 325
Target Start/End: Original strand, 5999075 - 5999189
Alignment:
| Q |
211 |
taagacacccttttggtgctttatttgaactaaatgataaaaaagaaaacttggacttaccctctaccttttttgatgattctatatttttgctgctgtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5999075 |
taagacacccttttggtgctttatttgaactaaatgataaaaaagaaaacttggacttaccctctaccttttttgatgattctatatttttgctgctgtt |
5999174 |
T |
 |
| Q |
311 |
ttcacctttgctact |
325 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
5999175 |
ttcacttttgctact |
5999189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University