View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11406_high_13 (Length: 298)

Name: NF11406_high_13
Description: NF11406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11406_high_13
NF11406_high_13
[»] chr1 (1 HSPs)
chr1 (18-280)||(26629559-26629821)
[»] chr5 (1 HSPs)
chr5 (90-274)||(29237147-29237331)
[»] chr7 (1 HSPs)
chr7 (15-53)||(42028140-42028178)


Alignment Details
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 26629821 - 26629559
Alignment:
18 aagtgtgctgaggtgactgaacgtgttctggctgcgtgctacaaagctttaagtgatcatcatgttctgctcgaaggaactcttttgaagcctaacatgg 117  Q
    ||||| ||||| || || ||||| ||||| || || || ||||| ||| ||||||| ||||||||||| || ||||| ||||||||||||||||| ||||    
26629821 aagtgcgctgatgtaacagaacgcgttcttgcagcatgttacaaggctctaagtgaccatcatgttcttcttgaaggtactcttttgaagcctaatatgg 26629722  T
118 taacccccggtttagattctcaaaaagttgcccctgaagttatagctgaatataccgttaaggccttgcagcgaactgttccggctgcagttcctgctgt 217  Q
    | || || || | ||||||||  |||||||| ||||| ||||||||  || | |||||    || |||  | |||| ||||| || || ||||||||| |    
26629721 ttacaccaggatcagattctcctaaagttgctcctgaggttatagcccaacacaccgtccgagcattgttgagaaccgttcctgccgcggttcctgctat 26629622  T
218 tgtgttcttgtctggtggacagagcgaggaggaggcaacactcaacctcaatgccatgaacaa 280  Q
     || ||||||||||||||||| || || ||||| ||| |  | ||||| ||||| ||||||||    
26629621 agttttcttgtctggtggacaaagtgaagaggaagcatctgttaaccttaatgcaatgaacaa 26629559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 90 - 274
Target Start/End: Complemental strand, 29237331 - 29237147
Alignment:
90 gaaggaactcttttgaagcctaacatggtaacccccggtttagattctcaaaaagttgcccctgaagttatagctgaatataccgttaaggccttgcagc 189  Q
    ||||| ||||| ||||||||||||||||| ||||| || |  ||| | | ||| ||||| || || ||| | |||||  | |||||||  || ||||||     
29237331 gaaggcactctcttgaagcctaacatggttacccctggatctgatgcaccaaaggttgcacccgaggttgttgctgagcacaccgttagagctttgcaga 29237232  T
190 gaactgttccggctgcagttcctgctgttgtgttcttgtctggtggacagagcgaggaggaggcaacactcaacctcaatgccat 274  Q
    |||| || || |||||||| || |||||||| |||||||||||||||||||| ||||| ||||| |   |||||||||| |||||    
29237231 gaaccgtacctgctgcagtcccagctgttgttttcttgtctggtggacagagtgaggaagaggccagcgtcaacctcaacgccat 29237147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 53
Target Start/End: Original strand, 42028140 - 42028178
Alignment:
15 aacaagtgtgctgaggtgactgaacgtgttctggctgcg 53  Q
    |||||||||||||||||||||||||||||||||||||||    
42028140 aacaagtgtgctgaggtgactgaacgtgttctggctgcg 42028178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University