View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11406_high_15 (Length: 268)
Name: NF11406_high_15
Description: NF11406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11406_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 32168564 - 32168814
Alignment:
| Q |
1 |
tccaatttcatggttgcctcatccacaatttcaaagattgcttcaaagagctgaggaggaatttggcttcaatcatgacatgggccttaccattccttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168564 |
tccaatttcatggttgcctcatccacaatttcaaagattgcttcaaagagctgaggaggaatttggcttcaatcatgacatgggccttaccattccttgt |
32168663 |
T |
|
| Q |
101 |
gatgaagttgctttcgagtttcttacttcattgatcagataagaagtatggttttaaattgcagtctgcaaccgcaaatataaaggatttctaggtcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168664 |
gatgaagttgctttcgagtttcttacttcattgatcagataagaagtatggttttaaattgcagtctgcaaccgcaaatataaaggatttctaggtcttt |
32168763 |
T |
|
| Q |
201 |
gcaatttcgatcgcattggctacatttttctccatttttccacaatataaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168764 |
gcaatttcgatcgcattggctacatttttctccatttttccacaatataaa |
32168814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 8510773 - 8510665
Alignment:
| Q |
1 |
tccaatttcatggttgcctcatccacaatttcaaagattgcttcaaagagctgaggaggaatttggcttcaatcatgacatgggccttaccattccttgt |
100 |
Q |
| |
|
||||||||| |||||| | ||||| ||||||||||| ||||| ||||||||||| || |||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
8510773 |
tccaatttcttggttggcacatcctcaatttcaaagtttgctacaaagagctgaagatgaatttggcttcaatcatgatatgggacttactatcccttgt |
8510674 |
T |
|
| Q |
101 |
gatgaagtt |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
8510673 |
gatgaagtt |
8510665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University