View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11406_high_23 (Length: 214)
Name: NF11406_high_23
Description: NF11406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11406_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 14658646 - 14658827
Alignment:
| Q |
12 |
agaagcaaagggcacatattcgatgatcgtagtaccaagttacttttgacctaattgatattctttttagctaaaaatcattatgtatgcttataaattt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14658646 |
agaaacaaagggcacatattcgatgatcatagtactaagttacttttgacctaattgatattctttttagctaaaaatcattatgtatgcttataaattt |
14658745 |
T |
|
| Q |
112 |
gattttgcatgatcttgattctacaaaattgatttcagtataaatacatttacgttgttgctggttactcttgggtcacatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14658746 |
gattttgcatgatcttgattctacaaaattgatttcagtataaatacatttacattgttgctggttactcttgggtcacatt |
14658827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University