View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11406_low_19 (Length: 251)
Name: NF11406_low_19
Description: NF11406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11406_low_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 14658542 - 14658775
Alignment:
| Q |
18 |
atttttctagaactcccaccatggtcggaatatcatgacaacatgttattattattttttccttctctttttgaggtcaacacacttctccaaccagtgt |
117 |
Q |
| |
|
|||||||||||| | ||||| ||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14658542 |
atttttctagaatttccaccgtggtcagaatttcatgacagcatgttattattattttttccttctctttttgaggtcaacacatttctccaaccagtgt |
14658641 |
T |
 |
| Q |
118 |
tgttagaaacaaagggcacatattcgatgatcatagcactaagttacttctgacctaattgatattccttttagctaaaaaccattatgtatgtttataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
14658642 |
tgttagaaacaaagggcacatattcgatgatcatagtactaagttacttttgacctaattgatattctttttagctaaaaatcattatgtatgcttataa |
14658741 |
T |
 |
| Q |
218 |
atttgattttacatgatcttgattctacaaaatt |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
14658742 |
atttgattttgcatgatcttgattctacaaaatt |
14658775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University