View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11406_low_24 (Length: 224)
Name: NF11406_low_24
Description: NF11406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11406_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 32516565 - 32516758
Alignment:
| Q |
18 |
gaaggtgacaaaatttcaaagactttttgatggtgatggctggacaaatatttgcagtggtcctaatcctgccctggatcagtgatgttatgctgaaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
32516565 |
gaaggtgacaaaatttcaaagactttttgatggtgatggctagacaaatatttgcagtggtcctactcctgccctggatcactgatgttatggtgaaaat |
32516664 |
T |
 |
| Q |
118 |
agagcgacacaaaagcaaggggaaaagaaagactgagtgcatactggaagaggaaaaccccg-tctcggtgtttggctgtttgctacctctgtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
32516665 |
agagcgacacaaaagcaaggggaaaagaaagactgagtgcatattggaagaggaaaaccccgttctcggtgtttgactgtttgctgcctctgtg |
32516758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University