View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11407_high_15 (Length: 309)
Name: NF11407_high_15
Description: NF11407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11407_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 82 - 282
Target Start/End: Complemental strand, 36932584 - 36932384
Alignment:
| Q |
82 |
gacattatatgagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacg |
181 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36932584 |
gacattgtaagagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttgacg |
36932485 |
T |
|
| Q |
182 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgtctctt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36932484 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgcctctt |
36932385 |
T |
|
| Q |
282 |
g |
282 |
Q |
| |
|
| |
|
|
| T |
36932384 |
g |
36932384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 127 - 238
Target Start/End: Complemental strand, 990422 - 990311
Alignment:
| Q |
127 |
taactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990422 |
taactgttccatggctttgagccaaacaggttcggccatggccaaacccttgacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
990323 |
T |
|
| Q |
227 |
gttcccacttct |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
990322 |
gttcccacttct |
990311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University