View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11407_high_16 (Length: 309)
Name: NF11407_high_16
Description: NF11407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11407_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 100 - 308
Target Start/End: Original strand, 32982277 - 32982485
Alignment:
| Q |
100 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982277 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
32982376 |
T |
|
| Q |
200 |
cttcactacttctatactccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatccca |
299 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982377 |
cttcactacttctatactccacagtgtccacaacattcatatcagcctcagctgtggttgtctcagtcaccaattgtacagttttctttgttgcatccca |
32982476 |
T |
|
| Q |
300 |
tgcagtttc |
308 |
Q |
| |
|
||||||||| |
|
|
| T |
32982477 |
tgcagtttc |
32982485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 215 - 308
Target Start/End: Original strand, 27037952 - 27038045
Alignment:
| Q |
215 |
actccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatcccatgcagtttc |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
27037952 |
actccgcagtgtccacggcattcatatcagcctcagcagtggttgtctctgtcaccaattgtacagtgttctttgtagcatcccatgcagtttc |
27038045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University