View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11407_high_3 (Length: 534)
Name: NF11407_high_3
Description: NF11407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11407_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 36086048 - 36085951
Alignment:
| Q |
16 |
attcaactgaatttgatgatgaatttctgatttgtgagtttcatgatcctaattg-tgagttttttctaatttatgagttttaggttttagattcttatg |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||||||| ||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
36086048 |
attcaactgaatttgatgatgagtttctgatttg--agtttcacgatcctaatttatgagtttaatctagtttatgagttttaggttttagattcttatg |
36085951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 355 - 410
Target Start/End: Complemental strand, 24414383 - 24414328
Alignment:
| Q |
355 |
ttgttagtgaagaattgaagatttcttccttccatctattaattgtatcggtttga |
410 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24414383 |
ttgttagtgcagaattgaagatttcttccttccatctattaattgtatcggtttga |
24414328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 317 - 359
Target Start/End: Original strand, 1759099 - 1759141
Alignment:
| Q |
317 |
ttgtaatgttaggttttagaattgaaatgttagtgtgtttgtt |
359 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
1759099 |
ttgtaatgttaggttttaggattgaaatgttagtgtatttgtt |
1759141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 298 - 337
Target Start/End: Original strand, 31038975 - 31039014
Alignment:
| Q |
298 |
tgaatttttaattgaatacttgtaatgttaggttttagaa |
337 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31038975 |
tgaatttaaaattgaatacttgtaatgttaggttttagaa |
31039014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 376 - 437
Target Start/End: Complemental strand, 439948 - 439887
Alignment:
| Q |
376 |
tttcttccttccatctattaattgtatcggtttgagaagctaaaagagagaaagcagtgtga |
437 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
439948 |
tttcttccttccatctgttaattgaattggtttgagaagctaaaagagagaaattagtgtga |
439887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 79 - 111
Target Start/End: Complemental strand, 1335093 - 1335061
Alignment:
| Q |
79 |
ttctaatttatgagttttaggttttagattctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1335093 |
ttctaatttatgagttttaggttttagattctt |
1335061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 367
Target Start/End: Original strand, 31184231 - 31184299
Alignment:
| Q |
297 |
ctgaatttttaattgaatacttgtaatgttaggttttagaattgaaatgttagtgtgtttgttagtgaaga |
367 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||||||||||||||||||| || ||||||||| |||||| |
|
|
| T |
31184231 |
ctgaatttttaattcaatacttgttat--taggttttagaattgaaatgtttgtttgtttgttaatgaaga |
31184299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 323 - 360
Target Start/End: Complemental strand, 14983522 - 14983485
Alignment:
| Q |
323 |
tgttaggttttagaattgaaatgttagtgtgtttgtta |
360 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14983522 |
tgttaggttttaaaattgaaatgttagtgtgtttgtta |
14983485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University