View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1140_high_13 (Length: 377)
Name: NF1140_high_13
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1140_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 230 - 348
Target Start/End: Original strand, 39652701 - 39652815
Alignment:
| Q |
230 |
ttataaactttcttaagaacaacattaaagaaaaaagattctgatttctaagaatgatagcaagtgagtggtggttctaaatatccatcaactgtgcatt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
39652701 |
ttataaactttcttaagaacaacattaaagaaaaaagattgtgatttctaagaatgataaca----agtggtggttctaaatatccatcaactgtgcatt |
39652796 |
T |
|
| Q |
330 |
gaggacgtagcccaattac |
348 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39652797 |
gaggacgtagcccaattac |
39652815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 145 - 222
Target Start/End: Original strand, 39652108 - 39652185
Alignment:
| Q |
145 |
ttggacaagacatatctattgtatcttagcgaaccttcaagatcacaatccaattgaggaaactttctttttcttgac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39652108 |
ttggacaagacatatctattgtatcttagcgaacctttaagatcacaatccaattgaggaaactttctttttcttgac |
39652185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University