View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1140_high_17 (Length: 343)
Name: NF1140_high_17
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1140_high_17 |
 | |
|
| [»] scaffold0608 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 54 - 315
Target Start/End: Complemental strand, 46926279 - 46926021
Alignment:
| Q |
54 |
agagcatgaatggataagcatgttaacagaaaaacaagagtacaacttacaaagtccattgtttcttgaaaatgatgatctcaatgtgagtgaatattgt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926279 |
agagcatgaatggataagcatgttaacagaaaaacaagagtacaacttacaaagtccattgtttcttgaaaatgatgatctcaatgtgagtgaatattgt |
46926180 |
T |
|
| Q |
154 |
gttgatgcatctctcctttgcctgcaacccaatttatacatgatccttcatacacaagttgaattaatattagtttaatgatctaattttggcataaact |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926179 |
gttgatgcatctctcctttgcctgcaacc---tttatacatgatccttcatacacaagttgaattaatattagtttaatgatctaattttggcataaact |
46926083 |
T |
|
| Q |
254 |
tccacaatgtaggttcaaatcaaattaatgttgactattttgaagaaagaaaaacatatact |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926082 |
tccacaatgtaggttcaaatcaaattaatgttgactattttgaagaaagaaaaacatatact |
46926021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 225
Target Start/End: Original strand, 11107962 - 11108002
Alignment:
| Q |
185 |
atttatacatgatccttcatacacaagttgaattaatatta |
225 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
11107962 |
atttatacatgatccctcaaacacaagttgaattaaaatta |
11108002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 225
Target Start/End: Original strand, 3401 - 3441
Alignment:
| Q |
185 |
atttatacatgatccttcatacacaagttgaattaatatta |
225 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
3401 |
atttatacatgatccctcaaacacaagttgaattaaaatta |
3441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University