View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1140_high_30 (Length: 243)
Name: NF1140_high_30
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1140_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 31829983 - 31830204
Alignment:
| Q |
1 |
tgtttggttgctagtaagcaaatggttgggatatttctaacagtttgggtgaaaagcaatattagagatgatgttcgcaatatgaaagtgtcttgcgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31829983 |
tgtttggttgctagtaagcaaatggttgggatatttctaacagtttgggtgaaaagcaatattagagatgatgttcgcaatatgaaagtgtcttgcgttg |
31830082 |
T |
|
| Q |
101 |
gcagagggttgatgggatacctcggaaacaaggtaaatttgatcaaattctttgaagaagggggtttaaaatgaaaccagaggattcaatctcattttct |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31830083 |
gcagaggtttgatgggatacctcggaaacaaggtaaatttgatcaaattctttgaagaagggggtttaaaatgaaactagaggattcaatctcattttct |
31830182 |
T |
|
| Q |
201 |
tatgcttttcagggttcaatat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31830183 |
tatgcttttcagggttcaatat |
31830204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 38122581 - 38122441
Alignment:
| Q |
1 |
tgtttggttgctagtaagcaaatggttgggatatttctaacagtttgggtgaaaagcaatattagagatgatgttcgcaatatgaaagtgtcttgcgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |||||||| |||| || |||||||||||||| |||| |
|
|
| T |
38122581 |
tgtttggttgctagtaagcaaatggtaggggtatttctaacagtttgggtgaaaagtgatatcagagatgacgttcataacatgaaagtgtcttgtgttg |
38122482 |
T |
|
| Q |
101 |
gcagagggttgatgggatacctcggaaacaaggtaaatttg |
141 |
Q |
| |
|
| ||||| ||||||||||| || |||||||||||| ||||| |
|
|
| T |
38122481 |
gaagaggattgatgggatatcttggaaacaaggtacatttg |
38122441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University