View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1140_high_34 (Length: 207)
Name: NF1140_high_34
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1140_high_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 44 - 207
Target Start/End: Complemental strand, 42271935 - 42271772
Alignment:
| Q |
44 |
atcatcaaaaggtagtttgaaatgacaattagggtcagaatcatgtgtgtagtgattatgatccatattggatgaattagaattattcaaattagtagac |
143 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42271935 |
atcaccaaaaggtagtttgaaatgacaattagggtcagaatcatgtgtgtagtgattatgatccatattggacgaattagaattattcaaattagtagac |
42271836 |
T |
|
| Q |
144 |
aaattgttatttgtttgtgaatcaaagtggctactaacttcagggtcaggtggggcaatagacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42271835 |
aaattgttatttgtttgtgaatcaaagtggctactaacttcagggtcaggtggggcaatagacc |
42271772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University