View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1140_low_25 (Length: 369)
Name: NF1140_low_25
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1140_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 8e-43; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 156 - 279
Target Start/End: Complemental strand, 1906926 - 1906802
Alignment:
| Q |
156 |
ctcaaattttctcttccaagttctataagaaaacatggatcatagaaattatgatgggtttaattttccataaaaatgagacaccaaa-aaagaaagtat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
1906926 |
ctcaaattttctcttccaagttctataagaaaaaatggatcataaatattatgatgggtttagttttccataaaattgagacaacaaacaaagaaagtat |
1906827 |
T |
|
| Q |
255 |
caaagatactttatggaggatctag |
279 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
1906826 |
caaagatactttatggagaatctag |
1906802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 1907064 - 1906970
Alignment:
| Q |
33 |
aaggatgaatctttgctacctcttgtnnnnnnnnnttgttggagtttcaagagagatagaa--aacaaaagctcaacaatgaattttggctctatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||| |||||||| |||||||||||||||| |
|
|
| T |
1907064 |
aaggatgaatctttgctacctcttgtaaaaaaaa-ttgttggagtttcaagagagatagaaagaaaaaaaactcaacaaggaattttggctctatg |
1906970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 292 - 351
Target Start/End: Complemental strand, 1906520 - 1906462
Alignment:
| Q |
292 |
agggtaggcagatcaggcttaattcaatagcatcaaacaacataaaatagttctattggt |
351 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |||| |||| ||| ||||||| |
|
|
| T |
1906520 |
agggtaggcagttcaggctcaattcaatagcatcaaac-acatgaaattgttgtattggt |
1906462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 38179935 - 38179899
Alignment:
| Q |
7 |
ataattactttgaatggttggattcaaaggatgaatc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38179935 |
ataattactttgaatggttggattcaaaggatgaatc |
38179899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 38184604 - 38184568
Alignment:
| Q |
7 |
ataattactttgaatggttggattcaaaggatgaatc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184604 |
ataattactttgaatggttggattcaaaggatgaatc |
38184568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University