View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1140_low_29 (Length: 349)
Name: NF1140_low_29
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1140_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 79 - 252
Target Start/End: Complemental strand, 7110144 - 7109971
Alignment:
| Q |
79 |
attattcttttgtagttttagatggcctcaagatcgccgtcgacattatcttgaagttttcaacgaaaagcatatgccatgcgataattgcacatgggta |
178 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7110144 |
attattcttttgtagttttagatggcatcaagatcgccgtcgtcattatcttgatgttttcaacgaaaagcatatgccatgcgataattgcacatgggta |
7110045 |
T |
 |
| Q |
179 |
atacatgcaaagggaggttgtttgaatggacaatgtattccttggagaagcatccattaatggatgcatacaac |
252 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7110044 |
atacatgcaaatggaggctgtttgaatggacaatgtattccttggaaaagcatccattaatggatgcatacaac |
7109971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University