View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11410_low_5 (Length: 261)
Name: NF11410_low_5
Description: NF11410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11410_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 32967454 - 32967695
Alignment:
| Q |
1 |
ttttagtcctagagatagaaagtacccaaacggtgcaaggccaaacagggcagctgcttcagggtattggaaagccactggcactgataagaccatagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32967454 |
ttttagtcctagagatagaaagtacccaaacggtgcaaggccaaacagggcagctgcttcagggtattggaaagccactggcactgataagaccatagtg |
32967553 |
T |
 |
| Q |
101 |
gcatcattgccatgtggaggaggacgatcacaagagaacattattggtgtcaaaaaggctcttgttttttacaaaggaaaacccccaaagggtattaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32967554 |
gcatcattgccatgtggaggaggaagatcacaagagaacattattggtgtcaaaaaggctcttgttttttacaaaggaaaacccccaaagggtattaaga |
32967653 |
T |
 |
| Q |
201 |
ctaattggatcatgcatgaatatcgtcttcttgacaacaata |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32967654 |
ctaattggatcatgcatgaatatcgtcttgttgacaacaata |
32967695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 35772746 - 35772823
Alignment:
| Q |
14 |
gatagaaagtacccaaacggtgcaaggccaaacagggcagctgcttcagggtattggaaagccactggcactgataag |
91 |
Q |
| |
|
|||||||| |||||||| || || ||||| || ||||| || |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
35772746 |
gatagaaaatacccaaatggggccaggcctaatagggctgcaacttctgggtattggaaagctactggaactgataag |
35772823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University