View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11410_low_7 (Length: 242)
Name: NF11410_low_7
Description: NF11410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11410_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 127
Target Start/End: Complemental strand, 8413441 - 8413333
Alignment:
| Q |
19 |
tcctgctcttagaaaactctacgttggtaacattcctcgtactgttagtaatgatgaacttgagaagattgttcaagaacatggtgctgttgaaaaagct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8413441 |
tcctgctcttagaaaactctacgttggtaacattcctcgtactgttagtaatgatgaacttgagaaaattgttcaagaacatggtgctgttgaaaaagct |
8413342 |
T |
 |
| Q |
119 |
gaggtactc |
127 |
Q |
| |
|
||||||||| |
|
|
| T |
8413341 |
gaggtactc |
8413333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University