View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11411_high_11 (Length: 278)
Name: NF11411_high_11
Description: NF11411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11411_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 2719475 - 2719748
Alignment:
| Q |
1 |
tcatttcaaaacaacataaaaaattgtttagattaatcttgatagtgggccttttctttgtgagtgccatttagtnnnnnnnnnt-----atattagggg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
2719475 |
tcatttcaaaacaacataaaaaattgtttagattaatcttgatggtgggccttttctttgtgagtgccatttagtaaaaaaaaaataaaaatattatggg |
2719574 |
T |
|
| Q |
96 |
atgagaagaaataatctgaaagggcattttctgtttgtaaatgaatcaataaaatcacctttttg--tctctcttttctctttgcaaaccctagctacca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
2719575 |
atgagaagaaataatctgaaagggcattttctgtttgtaaatgaatcaataaaatcacctttttgtctctctcttttctctttgcaaaccttagctacca |
2719674 |
T |
|
| Q |
194 |
ccattctttgtggtcgcaaatcggcctctagtggcctcattgtcacca-aaataaaaccctctcatcatactct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
2719675 |
ccattctttgtggtcgcaaatcggcctcgagtggcctcactgtcaccacaaataaaaccctctcatcatactct |
2719748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University