View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11411_high_14 (Length: 247)
Name: NF11411_high_14
Description: NF11411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11411_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 66 - 227
Target Start/End: Complemental strand, 22162868 - 22162707
Alignment:
| Q |
66 |
gtttgcataggtagatggagtaaacttgtgcagcaagttatgttgtctgttatcttgcatattatttggaaaatctcgatagaaagaaacagtagatatt |
165 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22162868 |
gtttgtataagtagatgtagtaaacttgtgcagcaagttatgttgtctgttatcttgcatattatttggaaaatctggatagaaagaaacagtagatatt |
22162769 |
T |
 |
| Q |
166 |
tttcagtatcagcacactaccatttctagcatgataaatggtataatagttgatgtccatct |
227 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
22162768 |
tttcaagatcagcacactaccatttctagcatgataaatggtataatagttgaagttcatct |
22162707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 22163545 - 22163488
Alignment:
| Q |
11 |
aagcaaaggtactaatcagcaacttgatatttcaaattggcatagtcttatcatcgtt |
68 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22163545 |
aagcaaaggtactgatcagcaacttgatatttcaaattggcatagtcttatcatcgtt |
22163488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University