View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11411_low_8 (Length: 381)
Name: NF11411_low_8
Description: NF11411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11411_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 2 - 341
Target Start/End: Complemental strand, 25989986 - 25989644
Alignment:
| Q |
2 |
aattggtgaatgttatgctcttcttgataggataatctagcatacttgttttgtttgattgtt-ctttgccttaacgttttctttgatatgcttttatcg |
100 |
Q |
| |
|
|||||| | ||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25989986 |
aattggaggatgctatgctctttttgataggataatctagcatacttgttttgtttgattgtttctttgcctcaacgttttctttgatatgcttttatcg |
25989887 |
T |
|
| Q |
101 |
ttcccttgtgctgtgttcgaaaggtcactcacaaaattttaagttcaagttgatcggttgcaatactttaatc-atacttacatttgaatatccttaatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25989886 |
ttcccttgtgctgtgttcgaaaggtcactcaccaaattttatgttcaagttgatcggttgcaatactttaatcaatacttacatttgaatatccttaatt |
25989787 |
T |
|
| Q |
200 |
ttcctaaactcattcaataattcattttctctctagctctcttttccca-cacaccaccctcttgatttatttctcttcaatggtagaatgaatgttttg |
298 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25989786 |
ttcctaaactcattcaacaattcattttctctctagctctcttttcccatcacaccaccctcttgatttatttctcttcaatggtagaatgaatgttttg |
25989687 |
T |
|
| Q |
299 |
gacagtaaatttatttggtcttgctaacttatgtcatgaggaa |
341 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25989686 |
gtcagtaaatttatttggtcttgctaacttatgtcgtgaggaa |
25989644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 30957612 - 30957673
Alignment:
| Q |
182 |
atttgaatatccttaattttcctaaactcattcaataattcattttctctctagctctcttt |
243 |
Q |
| |
|
||||| |||| || |||||||||| |||||||||| | || |||||||||||| |||||||| |
|
|
| T |
30957612 |
atttgtatattctaaattttcctacactcattcaacactttattttctctctatctctcttt |
30957673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University