View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11412_high_13 (Length: 252)
Name: NF11412_high_13
Description: NF11412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11412_high_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 252
Target Start/End: Complemental strand, 36127961 - 36127781
Alignment:
| Q |
72 |
caaagagcttgagttgatggcacatgaacaagctattgctggtgatagacaagcacatataattcaattcttgaacaaattctcgacaagtgctaattct |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127961 |
caaagagcttgagttgatggcacatgaacaagctattgctggtgatagacaagcacatataattcaattcttgaacaaattctcgacaagtgctaattct |
36127862 |
T |
 |
| Q |
172 |
tcatccctagcttcaatgtcaactcaacttcaagcttatttagcaacattaacttcaaactcttcttcttcaacattgcac |
252 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127861 |
tcatccctaacttcaatgtcaactcaacttcaagcttatttagcaacattaacttcaaactcttcttcttcaacattgcac |
36127781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University