View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11412_high_15 (Length: 250)

Name: NF11412_high_15
Description: NF11412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11412_high_15
NF11412_high_15
[»] chr3 (2 HSPs)
chr3 (1-135)||(52235152-52235287)
chr3 (196-243)||(52235045-52235092)


Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 52235287 - 52235152
Alignment:
1 acccaaatctagtagtaatgaaaatggagctattagtcaatggttgt-gacttgtgaggggtcacctagccgttgggtaatctgtaccgaacaccattac 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
52235287 acccaaatctagtagtaatgaaaatggagctattagtcaatggttgttgacttgtgaggggtcacctagccgttgggtaatctgtaccgaacaccattac 52235188  T
100 gtgcccttttggctttggattctttttcttaacggt 135  Q
    ||||||||||||||||||||||||||||||||||||    
52235187 gtgcccttttggctttggattctttttcttaacggt 52235152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 196 - 243
Target Start/End: Complemental strand, 52235092 - 52235045
Alignment:
196 tgcttaacgttaccgaacaattctgattacgaccctttgcctatgctt 243  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||    
52235092 tgcttaacgttaccgaacaattctgattacgaccctttgcctaagctt 52235045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University