View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11412_high_6 (Length: 351)
Name: NF11412_high_6
Description: NF11412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11412_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 94 - 156
Target Start/End: Complemental strand, 32007336 - 32007274
Alignment:
| Q |
94 |
agccacaaaagaaggttttggctttggctgctgtcagatttagagttcaatttatttggttct |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32007336 |
agccacaaaagaaggttttggctttggctgctgtcagatttagagttcaatttatttggttct |
32007274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 158 - 190
Target Start/End: Complemental strand, 32007248 - 32007216
Alignment:
| Q |
158 |
tacatggataattccaagtgccataaataaatt |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32007248 |
tacatggataactccaagtgccataaataaatt |
32007216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 228
Target Start/End: Original strand, 44810828 - 44810866
Alignment:
| Q |
190 |
ttttggtggctgaattgattgatgaagagaggtaaagag |
228 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44810828 |
ttttggtggctgaattcattgatgaagagaggtaaagag |
44810866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 125 - 193
Target Start/End: Complemental strand, 42114209 - 42114131
Alignment:
| Q |
125 |
tgtcagatttagagttcaatttatttggttcta----------tacatggataattccaagtgccataaataaattttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
42114209 |
tgtcagatttagagttcaatttatttggtgctatagtagcagttatatggataattccaagtgccataaataaaatttt |
42114131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University