View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11412_low_14 (Length: 250)
Name: NF11412_low_14
Description: NF11412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11412_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 42618319 - 42618087
Alignment:
| Q |
1 |
tgtatgaagaaatagagagtgttgggttgaaattcaaacatttc-tataaattggttatggnnnnnnnnnnnnntaaactattcggatactttcgcaaat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
42618319 |
tgtatgaagaaatagagagtgttgggttgaaattcaaacatttcctataaattggttaaggaaaaagaaaaaaataaactattcggatactttcgcaaat |
42618220 |
T |
 |
| Q |
100 |
ttaagttttctgaacgaggtatgtggtgttttttggtggtgtcatcaattgagccaaatctaatggattaagtactttaccaactagcagcaggatatta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42618219 |
ttaagttttctgaacgaggtatgtggtgttttttggtggtgtcatcaattgagccaaatctaatggattaagtactttaccaactagcagcaagatatta |
42618120 |
T |
 |
| Q |
200 |
catgtattttttggtgaactattacaagttcct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42618119 |
catgtattttttggtgaactattacaagttcct |
42618087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University