View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11412_low_15 (Length: 250)
Name: NF11412_low_15
Description: NF11412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11412_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 52235287 - 52235152
Alignment:
| Q |
1 |
acccaaatctagtagtaatgaaaatggagctattagtcaatggttgt-gacttgtgaggggtcacctagccgttgggtaatctgtaccgaacaccattac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52235287 |
acccaaatctagtagtaatgaaaatggagctattagtcaatggttgttgacttgtgaggggtcacctagccgttgggtaatctgtaccgaacaccattac |
52235188 |
T |
 |
| Q |
100 |
gtgcccttttggctttggattctttttcttaacggt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52235187 |
gtgcccttttggctttggattctttttcttaacggt |
52235152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 196 - 243
Target Start/End: Complemental strand, 52235092 - 52235045
Alignment:
| Q |
196 |
tgcttaacgttaccgaacaattctgattacgaccctttgcctatgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52235092 |
tgcttaacgttaccgaacaattctgattacgaccctttgcctaagctt |
52235045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University