View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11412_low_6 (Length: 351)

Name: NF11412_low_6
Description: NF11412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11412_low_6
NF11412_low_6
[»] chr6 (2 HSPs)
chr6 (94-156)||(32007274-32007336)
chr6 (158-190)||(32007216-32007248)
[»] chr1 (1 HSPs)
chr1 (190-228)||(44810828-44810866)
[»] chr5 (1 HSPs)
chr5 (125-193)||(42114131-42114209)


Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 94 - 156
Target Start/End: Complemental strand, 32007336 - 32007274
Alignment:
94 agccacaaaagaaggttttggctttggctgctgtcagatttagagttcaatttatttggttct 156  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32007336 agccacaaaagaaggttttggctttggctgctgtcagatttagagttcaatttatttggttct 32007274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 158 - 190
Target Start/End: Complemental strand, 32007248 - 32007216
Alignment:
158 tacatggataattccaagtgccataaataaatt 190  Q
    ||||||||||| |||||||||||||||||||||    
32007248 tacatggataactccaagtgccataaataaatt 32007216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 228
Target Start/End: Original strand, 44810828 - 44810866
Alignment:
190 ttttggtggctgaattgattgatgaagagaggtaaagag 228  Q
    |||||||||||||||| ||||||||||||||||||||||    
44810828 ttttggtggctgaattcattgatgaagagaggtaaagag 44810866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 125 - 193
Target Start/End: Complemental strand, 42114209 - 42114131
Alignment:
125 tgtcagatttagagttcaatttatttggttcta----------tacatggataattccaagtgccataaataaattttt 193  Q
    ||||||||||||||||||||||||||||| |||          || |||||||||||||||||||||||||||| ||||    
42114209 tgtcagatttagagttcaatttatttggtgctatagtagcagttatatggataattccaagtgccataaataaaatttt 42114131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University