View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11413_high_5 (Length: 470)
Name: NF11413_high_5
Description: NF11413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11413_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 8e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 4570101 - 4570346
Alignment:
| Q |
11 |
cataggtgatggtgcatctattccggtttggtataacaaatggatttcaaatgatgtctctctttattcnnnnnnnnnt-------gatgtctctcttat |
103 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
4570101 |
cataggtgatgatgcatctattccagtttggtataacaaatggattttaaatgatgtctctctttattaaaaataaaataaaaaatgatgtctctcttat |
4570200 |
T |
 |
| Q |
104 |
tccacggtacgatggtgaattcgatatagctgaccttcaagtatcaatatgatgatccaacctttaagtacgaataagttgacattcaatatcttaaggt |
203 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4570201 |
tccacggtacaatggtgaattc-------------ttcaagtatcaatatgatgatccaacctttaagtacgaataagttgacgttcaatatcttaaggt |
4570287 |
T |
 |
| Q |
204 |
tttgggtgaatctgagatgtccaatctc------gtagttggtcttattccaatatgat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4570288 |
tttgggtgaatctgagatgtccaatctcactagtgtaattggtcttattccaatatgat |
4570346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 316 - 426
Target Start/End: Original strand, 4570350 - 4570460
Alignment:
| Q |
316 |
ccatttgctcttatacattcaaaaatgacatttttaccctcaacagaagttaactactgtttgctggtctactgtagttaactgttgttccagatccaaa |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||| |||||||||| | ||| |||||||||| |
|
|
| T |
4570350 |
ccatttgctcttatacattcaaaaatgacatttttaccctctacagaagttaactactgtttcccggtctacggtagttaactatcgtttcagatccaaa |
4570449 |
T |
 |
| Q |
416 |
cctaaatatac |
426 |
Q |
| |
|
||||||||||| |
|
|
| T |
4570450 |
cctaaatatac |
4570460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 34 - 67
Target Start/End: Original strand, 8782467 - 8782500
Alignment:
| Q |
34 |
cggtttggtataacaaatggatttcaaatgatgt |
67 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
8782467 |
cggtttggtataacaaatggattgcaaatgatgt |
8782500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University