View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11413_high_9 (Length: 354)
Name: NF11413_high_9
Description: NF11413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11413_high_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 18 - 354
Target Start/End: Complemental strand, 6085532 - 6085196
Alignment:
| Q |
18 |
ctttgttcttgtccctagcatccttttccacaagcttaatcgtccatatttcttggcaggtaaaatggccaaagaattgacattaacatcgtcatcacgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085532 |
ctttgttcttgtccctagcatccttttccacaagcttaatcgtccatatttcttggcaggtaaaatggccaaagaattgacattaacatcgtcatcacgg |
6085433 |
T |
 |
| Q |
118 |
ccttttaatcctttcaaaactacgatcttttcaagtggctgtataaaatttctttcgcttgttttacaaaacttggcttttgcttcatcttcagcaagca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085432 |
ccttttaatcctttcaaaactacgatcttttcaagtggctgtataaaatttctttcgcttgttttacaaaacttggcttttgcttcatcttcagcaagca |
6085333 |
T |
 |
| Q |
218 |
tttgatccaatagggacggtcgatttttcaccttgtcttttaagggaacactaacactagttgtgtttgtaattataggacgacgatgagcggcaataat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085332 |
tttgatccaatagggacggtcgatttttcaccttgtcttttaagggaacactaacactagttgtgtttgtaattataggacgacgatgagcggcaataat |
6085233 |
T |
 |
| Q |
318 |
gttgtcgaaaattgacacatctgttgttgcagcaatt |
354 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6085232 |
gttgttgaaaattgacacatctgttgttgcagcaatt |
6085196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University