View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11413_low_13 (Length: 288)
Name: NF11413_low_13
Description: NF11413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11413_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 24945974 - 24946229
Alignment:
| Q |
17 |
cacatgtaacacagaatatgtcgacgacagtgtgccatcctgtgatcatcatccgttcttctttttctccgatggtgacattcacactgtcataacattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24945974 |
cacatgtaacacagaatatgtcgacgacagtgtgccatcctgtgatcatcatccgttcttctttttctccgatggtgacattcacactgtcataacatgg |
24946073 |
T |
 |
| Q |
117 |
attaaagagatgttatttgcaggactcatcttacaaaaccaagtttaaaggtgggatagagtttctaatgccatccaatagtagcaattgcacgattggt |
216 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24946074 |
attgaagagatgttatttgtaggactcatcttacacaaacaagtctaaaggtgggatagagtttctaatgccatccaatagtagcaattgcatgattggt |
24946173 |
T |
 |
| Q |
217 |
acataaacataccgcaaacatatcagtatta--atttttgg-tagaataagcatta |
269 |
Q |
| |
|
|| |||||||||||||||||||| ||||||| |||||||| ||||||||| |||| |
|
|
| T |
24946174 |
acgtaaacataccgcaaacatataagtattactatttttggatagaataagtatta |
24946229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University