View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11413_low_15 (Length: 249)
Name: NF11413_low_15
Description: NF11413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11413_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 96 - 212
Target Start/End: Complemental strand, 49462059 - 49461934
Alignment:
| Q |
96 |
cactaagccaaaaattgattacaatactatatcattttatactacccaaaaattaaaggaacctca---------tatgacatggtcaaaatgaacatgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49462059 |
cactaagccaaaaattgattacaatactatatcattttatactacccaaaaattaaaggaacctcaaaccattgttatgacatggtcaaaatgaacatgt |
49461960 |
T |
 |
| Q |
187 |
tgatagcagtgtctcattaagttttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49461959 |
tgatagcagtgtctcattaagttttt |
49461934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University