View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11413_low_17 (Length: 228)
Name: NF11413_low_17
Description: NF11413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11413_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 36933807 - 36933586
Alignment:
| Q |
7 |
gttgaatgagattgtctaccagcaaaatgacatgactgtatgtttgttgaagtcatatatacaagactgaattagactaagatgtgaactagatggagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36933807 |
gttgaatgagattgtctaccagcaaaatgacatgactgtatgtttgttgaagacatatatacaagactgaattagactaagatgtgaactagatggagaa |
36933708 |
T |
|
| Q |
107 |
atattatcagacaagtcaaaacccaacttagtttttctgaggatgtaacgcttgttcacactaatagaaataagaatagagtttcttttcccacccctga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36933707 |
atattatcagacaagtcaaaacccaacttagtttttctgaggatgtaacgcttgttcacactaatagaaataagaatagagtttcttttcccacacctga |
36933608 |
T |
|
| Q |
207 |
ttcggattatgaaatccgaaat |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36933607 |
ttcggattatgaaatccgaaat |
36933586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University